ID: 956746485

View in Genome Browser
Species Human (GRCh38)
Location 3:72314894-72314916
Sequence CCCTATGCCCAGCATGGAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956746485_956746491 14 Left 956746485 3:72314894-72314916 CCTACTCCATGCTGGGCATAGGG No data
Right 956746491 3:72314931-72314953 AGTCATGGCTTCTGCCCTCAAGG No data
956746485_956746492 15 Left 956746485 3:72314894-72314916 CCTACTCCATGCTGGGCATAGGG No data
Right 956746492 3:72314932-72314954 GTCATGGCTTCTGCCCTCAAGGG No data
956746485_956746489 -1 Left 956746485 3:72314894-72314916 CCTACTCCATGCTGGGCATAGGG No data
Right 956746489 3:72314916-72314938 GCTTCAGTGGTGACCAGTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956746485 Original CRISPR CCCTATGCCCAGCATGGAGT AGG (reversed) Intergenic
No off target data available for this crispr