ID: 956746487

View in Genome Browser
Species Human (GRCh38)
Location 3:72314900-72314922
Sequence CTGAAGCCCTATGCCCAGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956746487_956746496 29 Left 956746487 3:72314900-72314922 CCATGCTGGGCATAGGGCTTCAG No data
Right 956746496 3:72314952-72314974 GGGACTTCCAGTCTCGAAGAGGG No data
956746487_956746489 -7 Left 956746487 3:72314900-72314922 CCATGCTGGGCATAGGGCTTCAG No data
Right 956746489 3:72314916-72314938 GCTTCAGTGGTGACCAGTCATGG No data
956746487_956746492 9 Left 956746487 3:72314900-72314922 CCATGCTGGGCATAGGGCTTCAG No data
Right 956746492 3:72314932-72314954 GTCATGGCTTCTGCCCTCAAGGG No data
956746487_956746497 30 Left 956746487 3:72314900-72314922 CCATGCTGGGCATAGGGCTTCAG No data
Right 956746497 3:72314953-72314975 GGACTTCCAGTCTCGAAGAGGGG No data
956746487_956746495 28 Left 956746487 3:72314900-72314922 CCATGCTGGGCATAGGGCTTCAG No data
Right 956746495 3:72314951-72314973 AGGGACTTCCAGTCTCGAAGAGG No data
956746487_956746491 8 Left 956746487 3:72314900-72314922 CCATGCTGGGCATAGGGCTTCAG No data
Right 956746491 3:72314931-72314953 AGTCATGGCTTCTGCCCTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956746487 Original CRISPR CTGAAGCCCTATGCCCAGCA TGG (reversed) Intergenic
No off target data available for this crispr