ID: 956746488

View in Genome Browser
Species Human (GRCh38)
Location 3:72314903-72314925
Sequence TGCTGGGCATAGGGCTTCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956746483_956746488 -9 Left 956746483 3:72314889-72314911 CCATGCCTACTCCATGCTGGGCA No data
Right 956746488 3:72314903-72314925 TGCTGGGCATAGGGCTTCAGTGG No data
956746478_956746488 -3 Left 956746478 3:72314883-72314905 CCCCTACCATGCCTACTCCATGC No data
Right 956746488 3:72314903-72314925 TGCTGGGCATAGGGCTTCAGTGG No data
956746480_956746488 -5 Left 956746480 3:72314885-72314907 CCTACCATGCCTACTCCATGCTG No data
Right 956746488 3:72314903-72314925 TGCTGGGCATAGGGCTTCAGTGG No data
956746477_956746488 4 Left 956746477 3:72314876-72314898 CCAACAACCCCTACCATGCCTAC No data
Right 956746488 3:72314903-72314925 TGCTGGGCATAGGGCTTCAGTGG No data
956746479_956746488 -4 Left 956746479 3:72314884-72314906 CCCTACCATGCCTACTCCATGCT No data
Right 956746488 3:72314903-72314925 TGCTGGGCATAGGGCTTCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956746488 Original CRISPR TGCTGGGCATAGGGCTTCAG TGG Intergenic
No off target data available for this crispr