ID: 956746492

View in Genome Browser
Species Human (GRCh38)
Location 3:72314932-72314954
Sequence GTCATGGCTTCTGCCCTCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956746479_956746492 25 Left 956746479 3:72314884-72314906 CCCTACCATGCCTACTCCATGCT No data
Right 956746492 3:72314932-72314954 GTCATGGCTTCTGCCCTCAAGGG No data
956746487_956746492 9 Left 956746487 3:72314900-72314922 CCATGCTGGGCATAGGGCTTCAG No data
Right 956746492 3:72314932-72314954 GTCATGGCTTCTGCCCTCAAGGG No data
956746478_956746492 26 Left 956746478 3:72314883-72314905 CCCCTACCATGCCTACTCCATGC No data
Right 956746492 3:72314932-72314954 GTCATGGCTTCTGCCCTCAAGGG No data
956746483_956746492 20 Left 956746483 3:72314889-72314911 CCATGCCTACTCCATGCTGGGCA No data
Right 956746492 3:72314932-72314954 GTCATGGCTTCTGCCCTCAAGGG No data
956746480_956746492 24 Left 956746480 3:72314885-72314907 CCTACCATGCCTACTCCATGCTG No data
Right 956746492 3:72314932-72314954 GTCATGGCTTCTGCCCTCAAGGG No data
956746485_956746492 15 Left 956746485 3:72314894-72314916 CCTACTCCATGCTGGGCATAGGG No data
Right 956746492 3:72314932-72314954 GTCATGGCTTCTGCCCTCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956746492 Original CRISPR GTCATGGCTTCTGCCCTCAA GGG Intergenic
No off target data available for this crispr