ID: 956750464

View in Genome Browser
Species Human (GRCh38)
Location 3:72340483-72340505
Sequence CACCTGTGTGGTCTCCAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956750454_956750464 21 Left 956750454 3:72340439-72340461 CCACTTGGCAGAACTCGGATTGG No data
Right 956750464 3:72340483-72340505 CACCTGTGTGGTCTCCAGCAGGG No data
956750457_956750464 -5 Left 956750457 3:72340465-72340487 CCCAGATGCCTCTGCCACCACCT No data
Right 956750464 3:72340483-72340505 CACCTGTGTGGTCTCCAGCAGGG No data
956750458_956750464 -6 Left 956750458 3:72340466-72340488 CCAGATGCCTCTGCCACCACCTG No data
Right 956750464 3:72340483-72340505 CACCTGTGTGGTCTCCAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956750464 Original CRISPR CACCTGTGTGGTCTCCAGCA GGG Intergenic
No off target data available for this crispr