ID: 956751030

View in Genome Browser
Species Human (GRCh38)
Location 3:72344070-72344092
Sequence AAATGTGGGTAGGTGTATGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956751030_956751042 23 Left 956751030 3:72344070-72344092 CCCCCATACACCTACCCACATTT No data
Right 956751042 3:72344116-72344138 TACCTACCTCTTCCTTCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956751030 Original CRISPR AAATGTGGGTAGGTGTATGG GGG (reversed) Intergenic
No off target data available for this crispr