ID: 956753031

View in Genome Browser
Species Human (GRCh38)
Location 3:72359930-72359952
Sequence GGATGTGTGACTTCACATAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956753023_956753031 13 Left 956753023 3:72359894-72359916 CCCTCTGGAAAGGGTGACACAGA No data
Right 956753031 3:72359930-72359952 GGATGTGTGACTTCACATAATGG No data
956753024_956753031 12 Left 956753024 3:72359895-72359917 CCTCTGGAAAGGGTGACACAGAC No data
Right 956753031 3:72359930-72359952 GGATGTGTGACTTCACATAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956753031 Original CRISPR GGATGTGTGACTTCACATAA TGG Intergenic
No off target data available for this crispr