ID: 956753328

View in Genome Browser
Species Human (GRCh38)
Location 3:72362474-72362496
Sequence TTATAGGAGTTTCAGCTTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956753328_956753332 21 Left 956753328 3:72362474-72362496 CCAAAAAGCTGAAACTCCTATAA No data
Right 956753332 3:72362518-72362540 CTGAGAAGAAATAAGACTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956753328 Original CRISPR TTATAGGAGTTTCAGCTTTT TGG (reversed) Intergenic
No off target data available for this crispr