ID: 956753329

View in Genome Browser
Species Human (GRCh38)
Location 3:72362490-72362512
Sequence TCACTGGCTTCAGGTATTAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956753329_956753334 19 Left 956753329 3:72362490-72362512 CCTATAATACCTGAAGCCAGTGA No data
Right 956753334 3:72362532-72362554 GACTACTGGATGAATGTGCTGGG No data
956753329_956753333 18 Left 956753329 3:72362490-72362512 CCTATAATACCTGAAGCCAGTGA No data
Right 956753333 3:72362531-72362553 AGACTACTGGATGAATGTGCTGG No data
956753329_956753332 5 Left 956753329 3:72362490-72362512 CCTATAATACCTGAAGCCAGTGA No data
Right 956753332 3:72362518-72362540 CTGAGAAGAAATAAGACTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956753329 Original CRISPR TCACTGGCTTCAGGTATTAT AGG (reversed) Intergenic
No off target data available for this crispr