ID: 956753330

View in Genome Browser
Species Human (GRCh38)
Location 3:72362499-72362521
Sequence TCAGCAGATTCACTGGCTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956753330_956753332 -4 Left 956753330 3:72362499-72362521 CCTGAAGCCAGTGAATCTGCTGA No data
Right 956753332 3:72362518-72362540 CTGAGAAGAAATAAGACTACTGG No data
956753330_956753334 10 Left 956753330 3:72362499-72362521 CCTGAAGCCAGTGAATCTGCTGA No data
Right 956753334 3:72362532-72362554 GACTACTGGATGAATGTGCTGGG No data
956753330_956753335 24 Left 956753330 3:72362499-72362521 CCTGAAGCCAGTGAATCTGCTGA No data
Right 956753335 3:72362546-72362568 TGTGCTGGGAGTCTCCACCATGG No data
956753330_956753333 9 Left 956753330 3:72362499-72362521 CCTGAAGCCAGTGAATCTGCTGA No data
Right 956753333 3:72362531-72362553 AGACTACTGGATGAATGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956753330 Original CRISPR TCAGCAGATTCACTGGCTTC AGG (reversed) Intergenic
No off target data available for this crispr