ID: 956753334

View in Genome Browser
Species Human (GRCh38)
Location 3:72362532-72362554
Sequence GACTACTGGATGAATGTGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956753329_956753334 19 Left 956753329 3:72362490-72362512 CCTATAATACCTGAAGCCAGTGA No data
Right 956753334 3:72362532-72362554 GACTACTGGATGAATGTGCTGGG No data
956753331_956753334 3 Left 956753331 3:72362506-72362528 CCAGTGAATCTGCTGAGAAGAAA No data
Right 956753334 3:72362532-72362554 GACTACTGGATGAATGTGCTGGG No data
956753330_956753334 10 Left 956753330 3:72362499-72362521 CCTGAAGCCAGTGAATCTGCTGA No data
Right 956753334 3:72362532-72362554 GACTACTGGATGAATGTGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956753334 Original CRISPR GACTACTGGATGAATGTGCT GGG Intergenic
No off target data available for this crispr