ID: 956755426

View in Genome Browser
Species Human (GRCh38)
Location 3:72381209-72381231
Sequence CTGTTAGAATCTGTGAAAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 308
Summary {0: 1, 1: 0, 2: 3, 3: 29, 4: 275}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956755426_956755429 19 Left 956755426 3:72381209-72381231 CCCTTTTTCACAGATTCTAACAG 0: 1
1: 0
2: 3
3: 29
4: 275
Right 956755429 3:72381251-72381273 ACATTTTACTCCTTTTAAAGAGG 0: 1
1: 0
2: 2
3: 45
4: 398

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956755426 Original CRISPR CTGTTAGAATCTGTGAAAAA GGG (reversed) Intronic
900983861 1:6061700-6061722 CCGTTATAATCTGTGAAAATTGG - Intronic
903710760 1:25322337-25322359 CTCTTAGCATCTGTCAAAAAAGG - Intronic
903716332 1:25370070-25370092 CTCTTAGCATCTGTCAAAAAAGG + Intronic
905980986 1:42226994-42227016 CTATTATAAGCTGTGAAAAATGG + Intronic
907012059 1:50972023-50972045 CTATTATTTTCTGTGAAAAAAGG + Intronic
907610230 1:55861748-55861770 CTGCTAAGATCTGTGAAAAGTGG + Intergenic
907980886 1:59479669-59479691 GAGTCAGAATCTGTAAAAAATGG + Intronic
909217741 1:72912417-72912439 CTGTTAAAGTCAGAGAAAAATGG - Intergenic
911440065 1:97914911-97914933 CTGTTAGAATCTATGAGAAAGGG - Intronic
911763654 1:101646279-101646301 ATTTCAGAATCTGTGAAAAATGG + Intergenic
912650875 1:111438111-111438133 CTGTGAGCATCTGAGAAGAAAGG - Intergenic
915959880 1:160257032-160257054 CTGTTAAAATCAGTCAGAAAAGG - Intronic
916767189 1:167872736-167872758 CTGGTGGAATCAGTGCAAAAGGG + Intronic
917190735 1:172415828-172415850 CTGTTAAAATCTCACAAAAAAGG - Intronic
917880674 1:179332881-179332903 CTGCTAGGATCTGTGAAAGGAGG + Intronic
918669214 1:187193210-187193232 ATTTCAGAATCTGTGAAATAAGG - Intergenic
919163753 1:193865857-193865879 ATGTTGAAATATGTGAAAAAGGG - Intergenic
919660431 1:200239055-200239077 GTGTTAGAATGTGTGGGAAAAGG + Intergenic
919927301 1:202198943-202198965 CTTTTAGAATCTATTAGAAAGGG - Intronic
921247550 1:213260348-213260370 CTGTTTGAACCTCAGAAAAAGGG + Intronic
921332413 1:214052664-214052686 CTATTAGAATCTTTGAATACTGG - Intergenic
921705618 1:218319466-218319488 CTGTGAGAACCTGTGTAAACTGG + Intronic
923420213 1:233806918-233806940 CCATTAGAATCTGTAAAAACTGG - Intergenic
923841816 1:237680862-237680884 CTATTAGTATTTGTGATAAATGG + Intronic
924526340 1:244854079-244854101 CTGTTATTCTCTGTGAGAAATGG + Exonic
1063680139 10:8179355-8179377 GTGTTACCATCTGTGAAAAGAGG - Intergenic
1063838628 10:10045367-10045389 CTGTTATAATCTGTACACAATGG - Intergenic
1063875973 10:10479081-10479103 CTCTTAGAATCTGAGATAGATGG + Intergenic
1064359851 10:14654603-14654625 CTGTTTGTTTCTGTGCAAAATGG - Intronic
1065159451 10:22904012-22904034 CTGTTAGAGTATGGGAAAACAGG - Intergenic
1065249140 10:23792961-23792983 CTGTAAGGCACTGTGAAAAATGG - Intronic
1065417770 10:25507521-25507543 CTGGTAGAATCTGTGCAGCATGG - Intronic
1067724739 10:48761475-48761497 CTGTGAGAAGGTGTGAAGAAAGG + Intronic
1068268360 10:54684733-54684755 CTGTTAGATTTTCTGTAAAAAGG - Intronic
1068345117 10:55766732-55766754 CTGTTAGATTCTATTACAAATGG - Intergenic
1069087948 10:64163597-64163619 CATTTACAATCTTTGAAAAAAGG - Intergenic
1070224744 10:74491169-74491191 CTATAAGACACTGTGAAAAAAGG - Intronic
1070597455 10:77842557-77842579 CTGTTCGTATCTGTGAAATGAGG - Intronic
1072284340 10:93898491-93898513 CACTTAGAAACTGAGAAAAATGG - Intronic
1073675408 10:105641643-105641665 GTGGTAGAAGCTGGGAAAAAAGG + Intergenic
1075189753 10:120296282-120296304 GTTTTACAATCTGTGAAAGAGGG - Intergenic
1076237412 10:128876083-128876105 CTGGTATAATCTGTCAAACAGGG + Intergenic
1077448636 11:2619362-2619384 CTGTTAGAATTTATCAACAAAGG + Intronic
1078866063 11:15298461-15298483 CTGTTTGCCTCTGTGATAAATGG + Intergenic
1080296328 11:30733202-30733224 CTCTTAGAATATTTGCAAAAGGG + Intergenic
1080906023 11:36545701-36545723 TTGTTATAATCTGTTGAAAATGG - Intronic
1081000381 11:37662935-37662957 CTGTGAGAATCTAAGAAAAGAGG + Intergenic
1084995160 11:72969640-72969662 ATGTTAGAATCAATGAAATACGG + Intronic
1085137640 11:74107538-74107560 CTGTTATAATGTTTGATAAAAGG + Intronic
1087783223 11:102323918-102323940 ATCTTAGAATCAGTGAAATATGG + Exonic
1089723408 11:120451096-120451118 CTGGTAAAATGTGTGAAACATGG - Intronic
1090388394 11:126370316-126370338 CTGTTACTATTTGTGAAAAATGG + Intronic
1090752213 11:129756980-129757002 CTATTAGAATTGCTGAAAAAAGG - Intergenic
1093613561 12:21193395-21193417 CTCTTGGTATCTGTGAACAATGG - Intronic
1093776343 12:23079245-23079267 TTGTTAGGAGGTGTGAAAAATGG + Intergenic
1095558706 12:43539532-43539554 CTGGTAGAATTAGTGAAATATGG - Intronic
1096041755 12:48523368-48523390 ATTTTAGAACCTTTGAAAAAAGG + Intronic
1096136046 12:49202235-49202257 CAGTGAAAATCTGTGTAAAATGG + Intronic
1096924081 12:55122873-55122895 CTGGTTGACTCTGAGAAAAAAGG - Intergenic
1098106923 12:67077609-67077631 CTCTTAGAATCTGTGAAGTATGG - Intergenic
1098423844 12:70336273-70336295 CTATTAGAGACAGTGAAAAAGGG - Intronic
1098429954 12:70408246-70408268 CTGTTTGGAGGTGTGAAAAATGG + Intronic
1099615068 12:84923707-84923729 CTGTAAGCATCTGTGAATATGGG - Intergenic
1100281132 12:93119435-93119457 CTTTAAGAATCTGATAAAAAGGG + Intergenic
1102370126 12:112376180-112376202 TTGTTAGAACATGTGGAAAAAGG - Intronic
1105901358 13:24757161-24757183 GTGTTAGATTCTAGGAAAAAAGG + Intergenic
1106063898 13:26325134-26325156 CTGTTATAATCTCTGAGATATGG - Intronic
1107338050 13:39376619-39376641 CTGTTAGATTCTGAGAAAAAGGG - Intronic
1109215741 13:59587742-59587764 CAGCCATAATCTGTGAAAAAAGG + Intergenic
1109953451 13:69533644-69533666 ATGTTAAAATCTGTGAAGACAGG - Intergenic
1110131204 13:72013388-72013410 CTGTCAGACTCAGTGAGAAAAGG - Intergenic
1110738333 13:78964750-78964772 CTGTTTGTCTCTGTAAAAAATGG - Intergenic
1114073785 14:19138759-19138781 CTGTTAGAACTTGTGAAAATGGG + Intergenic
1114088479 14:19261226-19261248 CTGTTAGAACTTGTGAAAATGGG - Intergenic
1114931127 14:27468038-27468060 CTGTTATACTGTCTGAAAAATGG - Intergenic
1115308983 14:31960599-31960621 TTGTTAAAATATGTGAAAAGGGG + Intergenic
1116206808 14:41877780-41877802 GAGTTAGGATCTGTGTAAAACGG - Intronic
1116362489 14:44019306-44019328 CTATTAGATAGTGTGAAAAAGGG + Intergenic
1116747670 14:48842554-48842576 CTTTTGGAAGCTGTGGAAAATGG + Intergenic
1118527328 14:66661172-66661194 CTGTGAGAAGCTGTGGAAATGGG - Intronic
1118982258 14:70726363-70726385 CTGGAAGAATCTTTGGAAAAGGG - Intronic
1120035241 14:79689510-79689532 CTGTTAAAAGTTGTGAAAGATGG - Intronic
1120110835 14:80553886-80553908 CTGTTAGACACTGTGCAGAAGGG - Intronic
1120337168 14:83171572-83171594 CTTTTGGAATCTGTCAAAACTGG + Intergenic
1120358515 14:83464370-83464392 CTTGCAGAATCTGTGCAAAATGG + Intergenic
1121430878 14:93887499-93887521 CTGTTAGAATCAAGGAAATATGG - Intergenic
1121504068 14:94462871-94462893 CTGGGAGAATTTGTGGAAAAGGG + Exonic
1122181579 14:99958923-99958945 CTGATATGATATGTGAAAAAGGG + Intergenic
1124044560 15:26136818-26136840 CTGTTATCATGTGTTAAAAATGG - Intergenic
1125228096 15:37419018-37419040 GTGTTATAATCTGTGCAAAAAGG - Intergenic
1125480860 15:40079146-40079168 CTGATAGAATCTGAGAACAATGG + Intergenic
1126782020 15:52147003-52147025 CTGTCAGAAGCCTTGAAAAATGG - Intronic
1127802395 15:62488520-62488542 CTGTGAGAATCACTGCAAAATGG + Intronic
1130293077 15:82622106-82622128 CTTTTGGAATCTGTGAGGAATGG - Intronic
1131223562 15:90605597-90605619 CTCTTTGAATCTGTAAAAAGAGG + Intronic
1133671695 16:8028486-8028508 CAGCTAGAAGCTGTGAAAATGGG - Intergenic
1135270254 16:21063221-21063243 CTATTAGAATCTCTGGACAATGG - Intronic
1135966279 16:27037791-27037813 CTGGTGGAAACTGTGACAAATGG - Intergenic
1137753293 16:50882300-50882322 CTTTCAGAATCTGTGTCAAATGG - Intergenic
1137838178 16:51614622-51614644 CTGTAAGAATCAGTGAGCAAAGG - Intergenic
1140322340 16:73965395-73965417 GTTTTCTAATCTGTGAAAAAGGG - Intergenic
1140868877 16:79088632-79088654 ATGTTATCATCTGAGAAAAATGG - Intronic
1145389499 17:22444655-22444677 CAGATAGAATTGGTGAAAAAAGG + Intergenic
1145408120 17:22627495-22627517 CTGTTAGATTCTATTACAAATGG - Intergenic
1145414800 17:22705705-22705727 CTTCTAGAAACTGTGACAAAAGG + Intergenic
1145849971 17:28083575-28083597 CTGTTAGAACTTTTTAAAAATGG - Intronic
1147471117 17:40662277-40662299 CTATGACAATCTGTGAAATATGG + Intronic
1149797980 17:59539277-59539299 CTATTGGAATCAGTAAAAAACGG + Intergenic
1151510659 17:74557398-74557420 CTTTTACTATCTGTGAACAAGGG + Intergenic
1153315286 18:3715232-3715254 CTGTTGGAATGGGTGAGAAATGG + Intronic
1153458721 18:5309926-5309948 GTCTTTGAATCTGTGAAATAAGG - Intergenic
1153773013 18:8430554-8430576 TTGTTAGTTTCTGTGAAATATGG + Intergenic
1153975668 18:10266637-10266659 ATGTTATAATTTTTGAAAAAGGG - Intergenic
1155133033 18:22957782-22957804 ATAATAGTATCTGTGAAAAAGGG - Intronic
1155267533 18:24107959-24107981 CTGTTAGAGTCTGAGCAACATGG - Intronic
1156041734 18:32830765-32830787 GGGTTAGAATGTGTGAAAAAGGG + Intergenic
1156482815 18:37446761-37446783 CTGATAGACTCTCTGAAAACAGG - Intronic
1156805246 18:41170875-41170897 CTGTTAGAATTTTCAAAAAAAGG - Intergenic
1158338246 18:56436408-56436430 ACATTAGAATCTGTGAACAATGG + Intergenic
1159922844 18:74241574-74241596 CTGTTAAAAGCTTTGATAAAGGG + Intergenic
1163759089 19:19124346-19124368 CAATTAGAACATGTGAAAAAAGG + Intronic
1164450450 19:28358046-28358068 CTCTTTCAATCTGTGAAGAAGGG - Intergenic
1164468595 19:28509462-28509484 CTGTTTCAAACTGTTAAAAATGG + Intergenic
1165134229 19:33656395-33656417 ATCTTAGAATGTGTGAAATAGGG + Intronic
1165254801 19:34569589-34569611 CTTTTAGAATCTATAAAAACTGG - Intergenic
1168568798 19:57446886-57446908 CTGTAAAAATGTATGAAAAATGG + Intronic
925083383 2:1088272-1088294 GTGTTGGGATCTGAGAAAAATGG - Intronic
927311169 2:21633282-21633304 CTGTTAGTCTCTGTGAAACCCGG - Intergenic
927348569 2:22077968-22077990 GTGTTAAAATGTGTTAAAAATGG + Intergenic
927586146 2:24307204-24307226 ATTTTAGATTCTGTGAAATATGG - Intronic
927757045 2:25717182-25717204 ATGTTAGCATCTAGGAAAAAAGG + Intergenic
928622845 2:33108475-33108497 CTGTTACATTCAGGGAAAAAGGG + Intronic
930151450 2:48064244-48064266 CTGTTAGTCTCTCTGACAAAGGG - Intergenic
930970463 2:57388938-57388960 CTGTGAGAATGTGGAAAAAATGG + Intergenic
931616068 2:64159478-64159500 ATGTTAGAATCTGTAATGAATGG - Intergenic
933405794 2:81857868-81857890 TTTTCAGAATCTGTGAAAAAAGG + Intergenic
935677101 2:105604554-105604576 CTGTTAGCATCAGTGGATAAGGG + Intergenic
936849232 2:116875001-116875023 CTTTTAGAATTTGTCAAAACAGG - Intergenic
941484475 2:166062174-166062196 ATGTTTCAATCTGAGAAAAATGG - Intronic
942195457 2:173514294-173514316 CTGTTAGAATCTCTGGGAATAGG + Intergenic
943017025 2:182525986-182526008 AAGTTAGCATCTGTGAAGAAGGG + Intergenic
943206685 2:184907170-184907192 CTGTGACAATCTATGAAACATGG + Intronic
943413953 2:187575372-187575394 TTGTTTCCATCTGTGAAAAATGG + Intergenic
943636958 2:190317556-190317578 CTGTGAGATTCTGAGAAGAATGG + Intronic
943684779 2:190806883-190806905 TTGTTTTAATCTGTTAAAAATGG + Intergenic
944527250 2:200631705-200631727 CTGTTTAAATCTGTAAAGAAGGG - Intronic
944562062 2:200949628-200949650 CTTTCAGAATCATTGAAAAATGG - Exonic
944609671 2:201389494-201389516 CTGTTGGGCTCTGTCAAAAAAGG + Exonic
945177437 2:207057020-207057042 CTTTTAGCATCTCTGAAATAAGG + Intergenic
946392934 2:219427112-219427134 CTGTTGGCATCTTTGAAGAAGGG - Intergenic
947588671 2:231372064-231372086 GTGTTAAAATCTGAGAAAGAAGG + Intronic
1170269480 20:14508162-14508184 CCGTTAGGATCAGTGAAAACAGG + Intronic
1171467678 20:25342522-25342544 CTGTTGGAATGTTGGAAAAATGG - Intronic
1171940775 20:31327268-31327290 TTGTTTGTTTCTGTGAAAAATGG - Intergenic
1173858517 20:46266927-46266949 CTATTAGAACATGTGGAAAAAGG - Intronic
1174038470 20:47682786-47682808 CTGTTAGCACCTGTGGAAACAGG - Intronic
1174934234 20:54850111-54850133 ATGGAAGAATCTATGAAAAACGG - Intergenic
1175336697 20:58200804-58200826 GTGCTAGAAGCTGTGAAAGAAGG + Intergenic
1175612368 20:60362429-60362451 CTGTTGAGATCTGTTAAAAATGG - Intergenic
1176918532 21:14657066-14657088 CTGTTATAACCTTTGAAAAAGGG - Intronic
1177466425 21:21487794-21487816 CTGTTAGCATATCTGAAACATGG - Intronic
1178817539 21:35945445-35945467 CTGTTCGTATCAGTGCAAAAGGG - Intronic
1180492232 22:15861111-15861133 CTGTTAGAACTTGTGAAAATGGG + Intergenic
1182792594 22:32965501-32965523 CTGTTAGAAGCCGTGAAAGTAGG - Intronic
951712311 3:25596331-25596353 CTGTTAAAATATATGAAAATTGG + Intronic
952593845 3:34989868-34989890 CTCTTAAATTCTGTGAAAACTGG + Intergenic
952759050 3:36897651-36897673 ATGTTAGAATTTCTGAAAAATGG - Intronic
953119260 3:40023882-40023904 CTGTTACATCCTGTGAAAATGGG - Intronic
954244583 3:49320752-49320774 ATGTTAGAACATGTGGAAAAAGG - Intronic
956406871 3:68937118-68937140 CTATTAGTATCTGTGTAAAGCGG - Intergenic
956755426 3:72381209-72381231 CTGTTAGAATCTGTGAAAAAGGG - Intronic
957829806 3:85502928-85502950 CTTTTACAATCTTTTAAAAAGGG - Intronic
961232689 3:125332421-125332443 CTGTTAGACACTATTAAAAATGG + Intronic
961607597 3:128108477-128108499 TTGATAAAATCTGTGAAAACTGG - Intronic
961897405 3:130179915-130179937 CTGTTAGAAACTATCAAAACTGG - Intergenic
962532514 3:136296759-136296781 CATTTAGAATATGTGGAAAAAGG + Intronic
964020457 3:152004268-152004290 CCTCTACAATCTGTGAAAAATGG - Intergenic
964833368 3:160910326-160910348 CAGTGAGACTCTGTCAAAAAGGG - Intronic
965379589 3:167971723-167971745 CAGGTTGATTCTGTGAAAAACGG + Intergenic
966084309 3:176049466-176049488 TTTTTAGAATCATTGAAAAATGG - Intergenic
968329261 3:197850951-197850973 CTGAGGTAATCTGTGAAAAATGG - Intronic
969299564 4:6289802-6289824 CTCTTACAATCTGAAAAAAAAGG - Intronic
969646982 4:8436481-8436503 CTGTTAAGATCTAGGAAAAAGGG + Intronic
969699442 4:8759896-8759918 TGGTGAGAATGTGTGAAAAATGG + Intergenic
970091960 4:12419826-12419848 CTTTTCTAATCTGTTAAAAATGG - Intergenic
970694614 4:18662698-18662720 CTGTTAGGTTCTGTGAATGAGGG - Intergenic
971129059 4:23785828-23785850 CTGTAAGAATCTCTGGAAAGAGG + Intronic
971398886 4:26256610-26256632 ATTTCAGAACCTGTGAAAAATGG + Intronic
972620713 4:40745940-40745962 TTGCTAGAATCTGTTACAAATGG + Intergenic
974116062 4:57580485-57580507 CTGCTAGAGTCCATGAAAAATGG - Intergenic
974294553 4:59980211-59980233 CTGTTAGAGACTATGAAAACAGG + Intergenic
974638705 4:64600742-64600764 CTTTTTGAATCTGTGATAGACGG + Intergenic
975608386 4:76179383-76179405 CTTATAGAGTGTGTGAAAAATGG - Intronic
975925556 4:79446935-79446957 CTGTTATAAAATGTGAAAAATGG + Intergenic
976298019 4:83491168-83491190 CTGTTATAATGTGTTAAAATAGG + Intronic
976981510 4:91237286-91237308 CTGTTATAATCAGTGAAAGAAGG + Intronic
977148350 4:93475782-93475804 TTGATTGAATCTCTGAAAAATGG + Intronic
980455761 4:133040513-133040535 CTGTAAGGAGCTGGGAAAAAAGG - Intergenic
980574616 4:134668841-134668863 GTGTTATAATCAGTGAAAACTGG - Intergenic
980574623 4:134668919-134668941 GTGTTATAATCAGTGAAAACTGG - Intergenic
981438407 4:144753488-144753510 CTGTTTCAATCTGTGAGAAATGG - Intergenic
982905380 4:161062443-161062465 CTGTTAGAATCTTTTTTAAAAGG + Intergenic
983479737 4:168258108-168258130 CTGTTTGGATCTGACAAAAAGGG + Intronic
983713245 4:170746446-170746468 GTGTTAGAATGAGTGGAAAATGG + Intergenic
984104009 4:175521702-175521724 CTGTTAGAATCAGTGCTAAGAGG + Intergenic
984122119 4:175758604-175758626 CTTTTAGCATCTATAAAAAACGG - Intronic
986444674 5:7811047-7811069 CTGTTAGAAACTGTGAGTAATGG - Intronic
986572997 5:9184191-9184213 CTGTATAAATCTGTGAAACATGG - Intronic
987453410 5:18114058-18114080 GTTTTAAAATCTGTGATAAATGG - Intergenic
987497086 5:18659889-18659911 CTCTTAGCATATGTGAAACATGG - Intergenic
987577604 5:19751697-19751719 ATATTAGTCTCTGTGAAAAAGGG + Intronic
988799005 5:34678879-34678901 GTGTTAGATTCTGTGTAATAGGG - Intronic
989401036 5:41007726-41007748 GTTTTAGAATCAGTGAAATATGG - Intronic
990112368 5:52343315-52343337 AAATTAGAATCTGTGAAGAAAGG - Intergenic
990551609 5:56886425-56886447 CTGTTAGAAACTATCAACAAAGG - Intronic
990889904 5:60636595-60636617 CTGTTAGATTCTGTGGGAAAAGG - Intronic
990988736 5:61664577-61664599 CTGATAGAATCTGAGAGGAATGG - Intronic
992479779 5:77139074-77139096 CTGTCACAATCTGTGTAAAAGGG + Intergenic
993272807 5:85816969-85816991 CAGTTATAATTTTTGAAAAATGG - Intergenic
993471951 5:88317053-88317075 CTGTTAGAGGCTGGGAAAGATGG - Intergenic
994808955 5:104488582-104488604 CCCTTGGTATCTGTGAAAAATGG + Intergenic
996151789 5:120046300-120046322 CTGCTAGAAACTGTAAAAAGTGG + Intergenic
998557184 5:143136872-143136894 ATGTAATAATTTGTGAAAAAAGG + Intronic
999244394 5:150146015-150146037 CTGTAGGGCTCTGTGAAAAATGG - Intronic
1000035783 5:157446979-157447001 CTTTAAGAATCTGACAAAAAGGG - Intronic
1001810732 5:174626251-174626273 CTGACAGAATCTGTAAGAAAAGG - Intergenic
1002039278 5:176500125-176500147 CTGTTAGAGACTGTGAAAAGTGG - Exonic
1002998306 6:2307309-2307331 CAGATAGAAAATGTGAAAAAAGG + Intergenic
1003271003 6:4607836-4607858 CTGTTTTAATCTTTTAAAAACGG + Intergenic
1003732022 6:8835779-8835801 CTCTTAGAATTTGTGAATACTGG + Intergenic
1004656471 6:17666971-17666993 CTGATAACATCTGTGAAACATGG + Intronic
1006103013 6:31698122-31698144 ATTTTAGAATCTATGAAATATGG - Intronic
1009405620 6:63308763-63308785 CTGTTAGAAATAGTGGAAAAAGG + Intronic
1009643983 6:66373342-66373364 CTGTTAGGAACTGTGAAAGTGGG + Intergenic
1011399277 6:86942140-86942162 CTGTTAGCATCCAAGAAAAATGG + Intronic
1011913213 6:92467909-92467931 CTTTTAAAATCTGTAAAGAATGG - Intergenic
1012396269 6:98801057-98801079 ATGTTAGATTCTGTCAATAAGGG + Intergenic
1012496422 6:99838402-99838424 TGGGTAGATTCTGTGAAAAAGGG - Intergenic
1014196814 6:118569974-118569996 CTGTTATAGTCTTTGAAAGAAGG + Intronic
1014827336 6:126061265-126061287 ATGTTACAATCTGGGAAATATGG + Intergenic
1015194307 6:130508563-130508585 GTGTTAAAATCTGTGGAAGAGGG - Intergenic
1016885935 6:148959736-148959758 CTGTGAGAAGCTGAGACAAATGG - Intronic
1017081784 6:150676615-150676637 GTGCTAGAAGCTGTGAGAAATGG + Intronic
1017291022 6:152736809-152736831 CTGTAAGAATCAGTCAACAAGGG + Intergenic
1018359110 6:163047446-163047468 ATGTTAGAAGCTATGAAACAAGG + Intronic
1018882558 6:167899456-167899478 CAGTTAAAAGCTGTGAAGAATGG - Intronic
1020040007 7:4994885-4994907 CTGTCTGAGTCTGTGAAAACAGG - Intronic
1022210737 7:28206573-28206595 CAGTTAGAAACTGAGATAAAGGG - Intergenic
1022455345 7:30553778-30553800 GTGTTGGAATCTGTGAAAGTCGG - Intergenic
1022569761 7:31440758-31440780 ATGTTAGCATCTCTGAAAACTGG - Intergenic
1024125883 7:46294558-46294580 CTGTTAAAATTTATGACAAATGG + Intergenic
1024834984 7:53506402-53506424 CTGTTATTCTCTGTGAGAAATGG - Intergenic
1026092084 7:67308719-67308741 CTTTTTGATTCTGTGAAATAGGG + Intergenic
1028465284 7:91144522-91144544 CTGTCTGAATCTATTAAAAATGG - Intronic
1028753255 7:94406456-94406478 CTATGAGAGTCTGTGAAAAAAGG + Intronic
1029377513 7:100188596-100188618 CTTTTTGATTCTGTGAAATAGGG + Intronic
1030249473 7:107426587-107426609 CTATTAGTGTCTTTGAAAAAGGG - Intronic
1030290728 7:107870192-107870214 CTGACAAAATCTTTGAAAAATGG - Intergenic
1031227746 7:119062238-119062260 CTGTTATAATCTGCTAATAATGG - Intergenic
1031708930 7:125020804-125020826 TTTTTAGATACTGTGAAAAAAGG + Intergenic
1032364210 7:131284324-131284346 CTATCAGAATCTATGAAAATAGG - Intronic
1032721473 7:134553770-134553792 CTGTTAGAAACTATGGAAACTGG + Intronic
1033359472 7:140628220-140628242 CTGTTATAATCTGTAAAAGCTGG + Intronic
1033880849 7:145881824-145881846 TTTTTTAAATCTGTGAAAAATGG + Intergenic
1036058198 8:5284209-5284231 CTCTTGGAAACTGTAAAAAAAGG - Intergenic
1037441538 8:18921416-18921438 CAGTTAGAATCTGTGGGCAAGGG - Intronic
1038904964 8:31890435-31890457 AAGTTATAATATGTGAAAAAGGG + Intronic
1039927469 8:41949003-41949025 ATCTTAGAATCTATGAAATATGG - Intronic
1041433938 8:57817338-57817360 CTCTTAGAATCTTTGGAACATGG - Intergenic
1041555228 8:59146650-59146672 ATGTAAGAATCTGAGAGAAAGGG + Intergenic
1042333017 8:67602116-67602138 TTGTTATAATTTATGAAAAAAGG + Intronic
1042518178 8:69681744-69681766 CTGATATAGTCTATGAAAAATGG + Intronic
1042998579 8:74729497-74729519 ATCTTAGAATCTGTGAATCATGG + Intronic
1043975541 8:86580847-86580869 CTGTTAGAAACTGAGAAAGAAGG + Intronic
1045787917 8:105944469-105944491 CTGTGAGATGCTGAGAAAAATGG + Intergenic
1046311578 8:112444250-112444272 CTGTTAGCAAGTGTGTAAAATGG + Intronic
1048525774 8:135201146-135201168 CTGTTGTATTCTGTGGAAAAAGG - Intergenic
1048649357 8:136457251-136457273 CTGTTAGAATCTTGGATACATGG - Intergenic
1051514232 9:17910170-17910192 CTGGTAGGACCTGTGAAAAAAGG - Intergenic
1052893764 9:33728262-33728284 CTATTAGAATTGCTGAAAAAAGG - Intergenic
1053304232 9:36972725-36972747 CTGTTTGAAACTATGAAAATAGG + Intronic
1055357926 9:75456593-75456615 CTGTAAGTATGTGTGAAAAGGGG + Intergenic
1055424930 9:76184914-76184936 CTGCTATTATATGTGAAAAATGG + Intronic
1055822037 9:80277354-80277376 CTTTTAAAATATGTGAAATATGG + Intergenic
1057077514 9:92146425-92146447 CTCTTAGAATCTATTAGAAAGGG - Intergenic
1057780229 9:98043902-98043924 TTGTTAGAATTTGTGTAAAATGG - Intergenic
1057944121 9:99309703-99309725 CTGTGAAGATCTGTGAAACATGG - Intergenic
1059347738 9:113641918-113641940 CTGTTCAAATATGTTAAAAATGG + Intergenic
1185689964 X:2146388-2146410 CTCTTAGAAACTGCGAAAAAAGG + Intergenic
1186781208 X:12913849-12913871 CTAACAGAATCAGTGAAAAATGG + Intronic
1188418741 X:29971173-29971195 CTGGTAGAGTATGAGAAAAAAGG + Intergenic
1191112694 X:56819877-56819899 ATGTTAGAATGTGGGAAAACAGG + Intergenic
1191231143 X:58096581-58096603 ATTGTAGAATCTATGAAAAAGGG + Intergenic
1192190311 X:68987295-68987317 CTGTAAGATGCTGTGAAACAGGG + Intergenic
1192339819 X:70254711-70254733 ATGTCAGAACCTGTGAAATAGGG + Intergenic
1193155307 X:78166287-78166309 CTGCTAGAGTCTGGGGAAAAGGG + Intergenic
1193186235 X:78515966-78515988 CTGTAAGCATCTGTGACAAAAGG - Intergenic
1194735294 X:97505865-97505887 CTCTTAGAATCTGATAAATAGGG - Intronic
1194769436 X:97883393-97883415 CAGTTAGAAAATGTGTAAAAAGG + Intergenic
1196169581 X:112573085-112573107 GTGATAGAATCTGTGAAAAATGG + Intergenic
1196677546 X:118436496-118436518 GTTTTAGAATCAGTGAAATATGG + Intronic
1197638826 X:128946156-128946178 CTGTTGGAGTTTGTGACAAAAGG - Intergenic
1197943792 X:131816734-131816756 CTTCTAGAATCTGTGGACAAAGG - Intergenic
1199759580 X:150895085-150895107 CTGTAAGACTCTATGTAAAAGGG + Intronic
1200587309 Y:5023191-5023213 CTCTCAGAATGTGTTAAAAATGG + Intronic
1200846573 Y:7836873-7836895 CTGTTAGAAACTATCAAAACTGG + Intergenic
1202330886 Y:23751408-23751430 CTGTCAGAACCTCTGTAAAATGG - Intergenic
1202539883 Y:25918653-25918675 CTGTCAGAACCTCTGTAAAATGG + Intergenic