ID: 956756342

View in Genome Browser
Species Human (GRCh38)
Location 3:72391517-72391539
Sequence TGGGTTTTACAGAAGAAGTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 263
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 241}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956756342_956756349 29 Left 956756342 3:72391517-72391539 CCATACTTCTTCTGTAAAACCCA 0: 1
1: 0
2: 1
3: 20
4: 241
Right 956756349 3:72391569-72391591 GCTTCTTTCCCAACTTCTCCTGG 0: 1
1: 0
2: 3
3: 29
4: 300

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956756342 Original CRISPR TGGGTTTTACAGAAGAAGTA TGG (reversed) Intronic
902660572 1:17898998-17899020 TTGGTTTCACAGAATAAGTTAGG - Intergenic
904023431 1:27486264-27486286 GGGGTTTTAGAAAAGAAATATGG - Intronic
904495665 1:30885182-30885204 TGGGGTTTACAGAAGGAGGCTGG + Intronic
906269094 1:44460309-44460331 TGGGGTTCACTGAAGTAGTAAGG + Intronic
907340020 1:53728229-53728251 TGGGTCTTAAAGAATCAGTAGGG + Intronic
907635734 1:56133066-56133088 TGGGTTTTAAAGGAAAAGTAGGG + Intergenic
908750643 1:67419450-67419472 TGGGTTTTACTTAAGAAACATGG - Intronic
909731807 1:78901020-78901042 AGAATTTTACAGAAGAAATATGG - Intronic
909972067 1:82002599-82002621 TGGGTTTTGAAGGATAAGTAGGG + Intergenic
910516594 1:88068526-88068548 AGGGTATTACAAGAGAAGTAGGG + Intergenic
912334286 1:108847709-108847731 TGGGTGTTGCAGAAGGAATAGGG - Intronic
913044220 1:115059934-115059956 TGTGTTTTACAGAGGAAGAAAGG + Intronic
914339300 1:146745039-146745061 TGTGTTTTATAGAAGAGCTATGG + Intergenic
914517535 1:148386899-148386921 TGGCTTTTACACACTAAGTATGG - Intergenic
915239515 1:154510080-154510102 TGTGCTTTAGAGAAGGAGTAGGG + Intronic
915548760 1:156619425-156619447 GGGGTTGTACAGAAGAGGTCCGG + Exonic
915699826 1:157781272-157781294 TGGGTTTTCCAGAAGGTGGATGG + Intergenic
917166823 1:172121750-172121772 TGGGATTTACAGAGGAACCAGGG + Intronic
917690409 1:177462585-177462607 TAGGTTTTACAGATGGAGAAAGG + Intergenic
918332594 1:183473289-183473311 TGGGTTTTTCAGAAGAAACTGGG + Intronic
922274021 1:224060033-224060055 TGGGCTTTACAGAGGAAGGAAGG + Intergenic
1066437025 10:35404831-35404853 TGGGCTTGACTGAAGTAGTAGGG + Intronic
1068976177 10:63012371-63012393 TGGTGTTTACAGAAGAAGCGGGG + Intergenic
1069739984 10:70681294-70681316 TGGGTTTTAAAGGATCAGTAGGG + Intronic
1071329234 10:84543847-84543869 TGGGTTTGACAGAAGCCGTACGG + Intergenic
1073694895 10:105853783-105853805 AAGGCTTTAGAGAAGAAGTAGGG + Intergenic
1074222957 10:111456164-111456186 TGGCTTTTAGAAAAGAAGTTGGG + Intergenic
1074524303 10:114250921-114250943 TGGGTTATACAGATGAGGCAGGG + Intronic
1075717116 10:124562410-124562432 TGGGTTTGACAGCAGAATCAAGG + Intronic
1075763315 10:124873047-124873069 TGGATTGTACAGTAAAAGTATGG + Intergenic
1076286627 10:129305426-129305448 TGGGACACACAGAAGAAGTATGG + Intergenic
1076331871 10:129676074-129676096 TGGGAGTTACAGGAGAGGTAGGG - Intronic
1079151045 11:17899535-17899557 TGTATTTCACAGAAGAGGTATGG - Intronic
1081360563 11:42172227-42172249 TGGGACCTAAAGAAGAAGTAGGG - Intergenic
1081794355 11:45809353-45809375 TGGGTTTAGAGGAAGAAGTAGGG + Intronic
1086553006 11:88074277-88074299 TGGGTTTCACAGTAGAGTTATGG - Intergenic
1086968821 11:93058359-93058381 AGGGTTTTAAAGAAAAAGTTGGG + Intergenic
1087290302 11:96313838-96313860 AGGGTTTTACAGCAGAAATTTGG + Intronic
1088967621 11:114739457-114739479 TCAGTTTTACTGAAGAAGGAGGG - Intergenic
1089215129 11:116830452-116830474 TGGGTCTGCCAGAAGGAGTAGGG - Intronic
1090674519 11:128977573-128977595 TGGGTTTTCAAGGAGAAGTAGGG - Intronic
1091255305 11:134178949-134178971 TTGGTTTTACAGTAAAAATAAGG + Intronic
1091566244 12:1650475-1650497 CTGGTTTTACATAAGAAGTATGG + Intergenic
1092111268 12:5966461-5966483 TGGGCTTAATAAAAGAAGTATGG - Intronic
1093181286 12:15969741-15969763 TGATTTTTACACAAGAAGGATGG + Intronic
1093373907 12:18400135-18400157 TTAGTTTGAGAGAAGAAGTAGGG - Intronic
1093686354 12:22058753-22058775 TGAGTTCTAGGGAAGAAGTATGG + Intronic
1093940809 12:25051839-25051861 TAGCTTTTACAGAAAAAGAAAGG - Intronic
1098072638 12:66692605-66692627 TGGATTTTACAGAAGACCTGGGG + Intronic
1098472405 12:70860694-70860716 TATGTTTTACAGAAGAAGACTGG - Intronic
1100320781 12:93489834-93489856 TGGGTATTAAATAAGAAGGAAGG - Intronic
1101018699 12:100529680-100529702 TGGGCTTTGAAGAATAAGTAAGG - Intronic
1101503427 12:105325516-105325538 TGGTTTTTAAAGAATAAATAAGG + Intronic
1101687996 12:107044912-107044934 TGGGAGTTTCAGAAGAAGAAGGG + Intronic
1102771991 12:115486019-115486041 TGGATTTAACAGAGCAAGTAAGG + Intergenic
1103402442 12:120652240-120652262 TGGGTTTTAGAGAAGCGGGATGG + Intronic
1105444903 13:20445085-20445107 TGAGTTTTAAAGAAGAAAAATGG + Intronic
1105456063 13:20542289-20542311 AGGGTTTAAGAGAAGAAATAAGG + Intergenic
1105485932 13:20832584-20832606 TTTGTTTTACTGATGAAGTAGGG - Intronic
1106279779 13:28256230-28256252 TTGGTTTTAGAGAACAAGTCTGG - Intronic
1106774128 13:32991918-32991940 TGGGTTTTGAAGAAGAAGATGGG + Intergenic
1107156342 13:37171776-37171798 TGACTTTTACAGAAAAAGTTTGG - Intergenic
1107463284 13:40626115-40626137 TAGGTTTTAAATAAAAAGTAAGG - Intronic
1107639980 13:42431989-42432011 TGGGTTTTGAAGATGAAGGAAGG + Intergenic
1108894156 13:55302196-55302218 TGGGTTGTATAGATGAAGCAGGG - Intergenic
1110169970 13:72488818-72488840 TTGGTTTTACAGATGAGATATGG + Intergenic
1110188257 13:72700531-72700553 TGGGTTTTCTGGAAGAACTATGG + Intergenic
1110809361 13:79794555-79794577 TAGATATTACAGAAGAAGGAAGG + Intergenic
1110877790 13:80531820-80531842 TGGCATTTACAAAAGGAGTAAGG - Intergenic
1110981532 13:81905989-81906011 TGGGTTTTATAGAAAAAAAATGG - Intergenic
1112705507 13:102064160-102064182 TGGGTCTTAGAAAAGAACTAAGG + Intronic
1114524193 14:23358100-23358122 TGGATTTTACAGACTCAGTATGG - Intronic
1116304132 14:43228814-43228836 TCTGTCTTACAGAAAAAGTATGG - Intergenic
1119151273 14:72361825-72361847 TGTGTTTTAGAGAAGAGGGAGGG + Intronic
1119981367 14:79085155-79085177 TGGGTTATACAGTAAAAATAAGG + Intronic
1120111647 14:80564376-80564398 TGGGTTTGACAGATCAGGTAAGG + Intronic
1121671623 14:95714464-95714486 GGGGTCTTCCAGAAGAAGAAAGG - Intergenic
1123764110 15:23458037-23458059 TGGATTTTACCGAAGACGTCAGG + Intergenic
1124601748 15:31138371-31138393 TGGGGTTTAAAGTAGAAATAGGG - Intronic
1125190851 15:36991218-36991240 TTGATTTTACAGAAGAATTAAGG - Intronic
1127983856 15:64053189-64053211 TGGGTGTGAAAGAAGATGTATGG - Intronic
1130802049 15:87275145-87275167 TGGGTTTTCCAGGAGAAGGATGG + Intergenic
1131019291 15:89084857-89084879 TGCGTTTTACAGAAGAAAGTAGG + Intergenic
1135652365 16:24217538-24217560 TGGATTTTACCGTAGAAGTTGGG - Exonic
1137868657 16:51928350-51928372 TGGTTGTTACAGCAGAAGTTTGG + Intergenic
1139994975 16:70972313-70972335 TGTGTTTTATAGAAGAGCTATGG - Intronic
1140734931 16:77890113-77890135 TGGATTTTACAGATGAGGTGGGG + Intronic
1146747259 17:35343200-35343222 TGGATTTGAGTGAAGAAGTAAGG - Intergenic
1146821309 17:35985350-35985372 TGGCTTTTATAGGAGAAGCAAGG + Intronic
1149150132 17:53551874-53551896 TGGGTCTTATAGAAAAAGTGAGG + Intergenic
1149602157 17:57899966-57899988 TGGGTTTTACAGCATTGGTAAGG + Intronic
1150947557 17:69765159-69765181 TGTGTTATAGAGAAGAAGTAAGG - Intergenic
1153847815 18:9065589-9065611 TTGTTTTGACAGAAGAATTAAGG + Intergenic
1155888849 18:31241542-31241564 TGGTTTTTACAGTATAAGGAAGG + Intergenic
1156728743 18:40163236-40163258 TAGGTTTCAGAGAAGAAATATGG + Intergenic
1156927614 18:42601531-42601553 TGGGAATTACAGAAGAAATAAGG - Intergenic
1157284625 18:46369309-46369331 TGGGATTTACTGGAGAAGCAGGG + Intronic
1157597238 18:48871231-48871253 TGGGTTCTATAGAAGCAGTGGGG + Intergenic
1157725434 18:49960111-49960133 TGGGGTTTAGATAAGAAGTGTGG - Intronic
1158173687 18:54628733-54628755 TGGGTTTTGAAGAAGATGGATGG + Intergenic
1158569514 18:58585644-58585666 TGGATTTTACATAACAAGTATGG - Intronic
1158956732 18:62547389-62547411 TGGGGTCTACAGAAGAAAAAGGG - Intronic
1159983951 18:74820035-74820057 AGAGTATTACAGAAGAAGAAAGG + Intronic
1159990968 18:74907167-74907189 TGGCTTTTATACAACAAGTAAGG + Intronic
1160903708 19:1442055-1442077 TGGGTTGGACAGAGGAAGGATGG + Intergenic
1162624168 19:11870682-11870704 TAGTCTTTACAGAATAAGTAAGG - Intronic
1165178535 19:33948022-33948044 TGAGTTTTACAGAATGAATAGGG - Intergenic
1166665170 19:44675408-44675430 TGTGTTTTGCAGGAGATGTAGGG - Intronic
925779868 2:7372325-7372347 GGAGCTTTACAGGAGAAGTAGGG - Intergenic
926037581 2:9647256-9647278 TGGGTTTTAAAGAATGAATAAGG + Intergenic
927469872 2:23365340-23365362 TGGATTTAACAGCAGAAGAAAGG + Intergenic
929538353 2:42799682-42799704 TGTGTTTTAATGAAGAAGGAAGG - Intergenic
931652849 2:64484110-64484132 GTGGTTTTACAGAAGAAGGAGGG - Intergenic
933300480 2:80535159-80535181 TGAGTTTTACAAAAGAAACAAGG - Intronic
933432125 2:82196055-82196077 TGGGTTTTTCATAAGAAAAATGG + Intergenic
934749592 2:96784754-96784776 TGGGATTGACAGTAGATGTAGGG + Intronic
936553105 2:113467760-113467782 AGGTTTTTACAGATGGAGTAGGG + Intronic
937743497 2:125383728-125383750 TGGGTCATACAGAATAAATAAGG - Intergenic
938941839 2:136176472-136176494 TGGGTTTAAAAGAAGAAGGAAGG + Intergenic
939025894 2:137013689-137013711 TGGGTTTTAAAGAAGGATCAGGG - Intronic
939136784 2:138305741-138305763 TGTGATTTACAGAAGTATTAAGG + Intergenic
939488261 2:142844468-142844490 TTAGTTTTTCAGGAGAAGTAAGG - Intergenic
940046285 2:149413807-149413829 TGGGTTTTGGGGAAGAAGAAGGG + Intronic
941291006 2:163674889-163674911 TGGCTTTCTGAGAAGAAGTATGG + Intronic
941536044 2:166723189-166723211 AGAGATTTACAGAAGTAGTAAGG - Intergenic
943919447 2:193684670-193684692 TGGTTTTAACAGAAGAATAAAGG - Intergenic
944166511 2:196727643-196727665 TGCTTTTTATAGAAGAATTAGGG + Intronic
944684272 2:202104510-202104532 TGGTTTTCACAGAAGGAATATGG + Intronic
944767065 2:202874666-202874688 TGGATTTTACCGAAGACGTCAGG + Intergenic
945717559 2:213378610-213378632 TGGTTTTAACAAAAGAAGGAGGG + Intronic
947047062 2:225999633-225999655 TGAATTTTACAGAAAAAGAAGGG - Intergenic
947330706 2:229026368-229026390 TGGGGTTTAAAAAAGGAGTAAGG - Intronic
1169531922 20:6494573-6494595 TGGGAAATACAGAAGGAGTAAGG + Intergenic
1169599201 20:7237645-7237667 TGATTTTCACAGAAGTAGTATGG + Intergenic
1170797727 20:19564168-19564190 TGGGGTTTAGAGGAGTAGTAGGG + Intronic
1171954794 20:31453024-31453046 TGGGTTTAACAGCAGAAGATAGG + Intergenic
1172919668 20:38470936-38470958 TGGTTTTTACATAACATGTAAGG - Intergenic
1173046951 20:39521584-39521606 TGGCTTTTAGACAACAAGTATGG + Intergenic
1181845577 22:25706271-25706293 TGGGTGTCAGGGAAGAAGTACGG + Intronic
1183265214 22:36820697-36820719 TGGGGTTTGCTGAAGAAGGAAGG + Intergenic
949721458 3:6995212-6995234 TGCCTTTTACAGAAAAAGTCTGG - Intronic
949812315 3:8019228-8019250 TGGGTTTGACAATAGTAGTAAGG - Intergenic
952559525 3:34574620-34574642 TTGGTTTTAGAGAAGAAGTAAGG - Intergenic
952754546 3:36855065-36855087 AGGTTTTTACAGCTGAAGTAAGG - Intronic
953832301 3:46310768-46310790 AGGGTTTCATAGAAGAAGTCAGG - Intergenic
955031480 3:55225676-55225698 AGGGTTTTAGAGATGAGGTAAGG + Intergenic
955851808 3:63228092-63228114 TGGATTATACAGAAAAAGAAGGG + Intergenic
956756342 3:72391517-72391539 TGGGTTTTACAGAAGAAGTATGG - Intronic
957019958 3:75115049-75115071 TGTGGTTTAGGGAAGAAGTAAGG - Intergenic
957937248 3:86960395-86960417 TGGGTACTACAGAGGAAGTCAGG - Intronic
959731663 3:109610747-109610769 TGGCTATCACAGAAGAAGTTGGG - Intergenic
963292766 3:143509865-143509887 TATGTTTTACAGAACAAATAGGG - Intronic
964499816 3:157336289-157336311 TGAGTTTTACAGATGAGCTAAGG + Intronic
964851713 3:161103025-161103047 TGGGTTTTCCTGAAGAACCATGG + Intronic
965844752 3:172948021-172948043 TTGGCTTTAAAGAGGAAGTAGGG + Intronic
966337248 3:178882190-178882212 TGGGTCTGAGAGAAGAAGCAGGG - Intergenic
967289463 3:187904927-187904949 TGGTTTTTGCGGGAGAAGTAGGG - Intergenic
968119583 3:196115761-196115783 TGGGTGTTTCAGAACAAGTACGG - Intergenic
970341516 4:15112268-15112290 TTGATTTTACAGATGAAGAAAGG + Intergenic
971051294 4:22865986-22866008 TTTGTATTACAGAGGAAGTAGGG - Intergenic
971075565 4:23144987-23145009 GAGGTTTTACAGCAGAAATATGG + Intergenic
971608097 4:28684707-28684729 TGGATTTTACTGAAGGGGTAAGG + Intergenic
972185633 4:36524459-36524481 TGGTTTATACAGAAGAAACAGGG - Intergenic
973545855 4:51981435-51981457 TGTGTATTACAGAAGAAACAGGG - Intergenic
973699403 4:53521646-53521668 TATGTTTTATAGAAGGAGTAAGG - Intronic
974062657 4:57049623-57049645 AGGATTTTAGAGAAGAAATAAGG - Intronic
974415570 4:61602253-61602275 TGGGTTTTTCTGGAAAAGTAGGG - Intronic
976968501 4:91076079-91076101 TGTGTTTCAAAGGAGAAGTAAGG - Intronic
977491121 4:97713177-97713199 TGGGATTTAAAGAAGCAGAAAGG + Intronic
977749611 4:100593502-100593524 TTGATTTCACAGATGAAGTATGG - Intronic
978016997 4:103756734-103756756 TGGTTGTTACAGAAGAAACAGGG - Intergenic
978551216 4:109929307-109929329 TCTATTTTACAGAAGAAGAAAGG - Intronic
978800141 4:112748282-112748304 TGGGTTTTATAGAGTAAATATGG + Intergenic
980654235 4:135761169-135761191 TGGATTCTATAGAAGAAGTAGGG + Intergenic
981173183 4:141648567-141648589 AGGGTTTAAGAGAAGAAATATGG + Intronic
981728254 4:147870656-147870678 TGGGTTTTCCAGAAGAAATTTGG + Intronic
983312236 4:166079484-166079506 TAAGATTTACAAAAGAAGTATGG - Intronic
983392496 4:167150669-167150691 TTGATATTACTGAAGAAGTAAGG + Intronic
983756723 4:171347777-171347799 TGAGTTTTTCAGAAGATTTAGGG - Intergenic
985035540 4:185836203-185836225 AGCGTTTTACAGAAGCAGTTGGG + Intronic
987865846 5:23536812-23536834 GGGGCTTTACAGAAGAAAAATGG + Intergenic
988818202 5:34854985-34855007 AGGGTTGTAAAGAAGGAGTAGGG + Intronic
989217922 5:38924191-38924213 TGCCTTTTACAGATGAAGAATGG - Intronic
990061079 5:51649667-51649689 AGGGTAATAAAGAAGAAGTAGGG - Intergenic
991419152 5:66423422-66423444 TAGGGTTTCCAGAAGAAGAAGGG + Intergenic
992074144 5:73175573-73175595 TTGGTTTTGGAGAAGAAGTTTGG + Intergenic
993355533 5:86902580-86902602 TTGGTTTTACAGAAGGAGGAGGG - Intergenic
993776074 5:91998439-91998461 TGTGTTTCAAAGAAGAAGAAAGG - Intergenic
994071426 5:95607548-95607570 TGGCTTTTACAGAAAAAGATGGG - Intergenic
994328925 5:98483170-98483192 AGAGTTTTACAGAATAAATAGGG + Intergenic
994673052 5:102785384-102785406 TGTGTTTTACAAAAGAACTTTGG + Intronic
995739193 5:115336876-115336898 TTGGTTTTAGAGAAGATGAATGG - Intergenic
996407330 5:123118480-123118502 TGGGTTTGACTCAACAAGTAAGG + Intronic
996739029 5:126782239-126782261 AGGGTTTTACAGAAAAGATACGG - Intronic
999562470 5:152819719-152819741 TGTGCTTAACAGGAGAAGTAGGG - Intergenic
999575665 5:152973737-152973759 TAAGTTTTACTGAAGAATTAGGG - Intergenic
999736184 5:154515024-154515046 TGCATTTTACAGAAGAGGAAAGG - Intergenic
999860634 5:155641939-155641961 TGAGTTTTACAGATGAAATGGGG + Intergenic
1003886062 6:10522507-10522529 GTGGTTTTCCAGAAGAAATAGGG + Intronic
1004306436 6:14505858-14505880 TGGGCTGTAAAGAAGAAGTTAGG - Intergenic
1004404012 6:15314820-15314842 TTGGTTTTACTGAAGCAGTCGGG - Intronic
1004641095 6:17516071-17516093 TGAGTCTTGCAGAAGAGGTAGGG - Intronic
1004942410 6:20573548-20573570 TGACTTTTACAGTAAAAGTATGG - Intronic
1008108767 6:47469636-47469658 TTGGTTTTATAGAATAAGTTTGG - Intergenic
1008217036 6:48805206-48805228 TAGGTATTGCAGAAGAAGGATGG - Intergenic
1009952884 6:70416874-70416896 TAGGTTTTTCAGAAGGAATAAGG + Intronic
1010998204 6:82557702-82557724 GGGGTTTCACAGAGGAATTAGGG - Intergenic
1012090912 6:94895480-94895502 TTGCTTTGAAAGAAGAAGTAAGG - Intergenic
1012384910 6:98669178-98669200 TGTGTTTTACATAAAAAGAAAGG - Intergenic
1012771700 6:103445225-103445247 TAGGTTTTTCAGAATAATTATGG + Intergenic
1013497445 6:110712526-110712548 TGGATTTCACAAAAGAAGTCTGG + Intronic
1013707483 6:112855208-112855230 AGGGTTTTATAGAAAAAGCAAGG + Intergenic
1013748280 6:113371166-113371188 TAGGTTTTAAGGAAGAAGTGAGG + Intergenic
1014392129 6:120875263-120875285 TGGGTCATACAGAATAACTAAGG - Intergenic
1016621239 6:146110926-146110948 AGGGTTTTAAAGAAGAAAGAAGG + Intronic
1017335451 6:153253312-153253334 TGGGTATTTAAGAAGAAGTCTGG + Intergenic
1017916746 6:158837050-158837072 TGGGTCTTAAAGGATAAGTAGGG - Intergenic
1019832924 7:3350924-3350946 TGGGTATTAAAGGAGAATTATGG + Intronic
1021803082 7:24327615-24327637 TGGGTTGTTCAGAGGAAGTATGG - Intergenic
1022766583 7:33419097-33419119 TAGGTTTTAAACAAGATGTAAGG - Intronic
1028379144 7:90178464-90178486 TGGATTTTAGAGAAGCAGTTGGG - Intronic
1028784467 7:94775577-94775599 TTGGATTTACAGAAAAATTAAGG - Intergenic
1030013807 7:105198271-105198293 TGGGGTTTTCAGAGGCAGTAGGG - Intronic
1031077695 7:117228629-117228651 TGGGTCTTCGAGAAGAGGTATGG - Intronic
1031203041 7:118715786-118715808 TGGGTTTTGTAGAAGAGGTTTGG + Intergenic
1033311388 7:140264516-140264538 TGGGTATAGCAGAAGAAGAAGGG - Intergenic
1033564105 7:142562027-142562049 TGGGCTTTAGAGAAGTAGGAAGG - Intergenic
1034460874 7:151197389-151197411 TGGGTTTTACAGAAGAGAGCTGG + Intronic
1036179728 8:6573852-6573874 TGGGTTTTACAGTACACATAAGG + Intronic
1036555064 8:9852051-9852073 TGGGGATTACAGAGGAAGAAGGG + Intergenic
1036604073 8:10290963-10290985 TGGATTTTCCAGAATAAGAAGGG - Intronic
1040972619 8:53153450-53153472 TAGGTTTTAAAAAAGAAGTTGGG + Intergenic
1042496911 8:69465318-69465340 TGAGTTATAAAGAAGAAGGAGGG - Intergenic
1045301152 8:100911335-100911357 TGGTTTTTACAAAGGAAGAAAGG + Intergenic
1046320791 8:112571537-112571559 TGGGTTTCACAGAAGAAACCTGG - Intronic
1046638045 8:116694951-116694973 TGGGATAAACAGAGGAAGTATGG - Intronic
1047712391 8:127565683-127565705 TGGGGTTGACAGAAGAAGGCAGG - Intergenic
1048444600 8:134484012-134484034 TGGGTTTTACGAAGGAAGTGAGG - Intronic
1049899895 9:149428-149450 AGGCTTTTACAGATGGAGTAGGG - Intronic
1051121165 9:13753868-13753890 TGGGTTCTCCAGAGGAAGAATGG - Intergenic
1052025810 9:23571908-23571930 TGGGCTAGACAGAAGAGGTACGG + Intergenic
1053742944 9:41159719-41159741 AGGTTTTTACAGATGGAGTAGGG - Intronic
1054348221 9:63989543-63989565 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054445947 9:65315902-65315924 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054484323 9:65705608-65705630 AGGTTTTTACAGATGGAGTAGGG + Intronic
1054685399 9:68271581-68271603 AGGTTTTTACAGATGGAGTAGGG + Intronic
1055304453 9:74914843-74914865 TGGGTTTTAAAAAAAAATTATGG - Intergenic
1055424645 9:76181612-76181634 TGGGTTTTAGAGAAGAAATGTGG + Intronic
1056171193 9:83986396-83986418 TGGGTTTTATAGATGAATTGAGG + Intronic
1059235935 9:112760781-112760803 TGGGTTTTACCTGAGGAGTAGGG + Intronic
1059571575 9:115443188-115443210 TGTGTTTTGCAGGAGCAGTAGGG + Intergenic
1059573856 9:115469038-115469060 TTCCCTTTACAGAAGAAGTAAGG + Intergenic
1059782359 9:117543410-117543432 TCTGTTTTACAGAACAAGCAAGG - Intergenic
1060194213 9:121612787-121612809 TGGGTTTCCCAGAGGAAGAAAGG + Intronic
1060815513 9:126633076-126633098 AGAGTTTTCCAGAAGAAGAAAGG - Intronic
1187110204 X:16290530-16290552 TTGGTTTTAAAGAATAAATAAGG - Intergenic
1187548340 X:20275536-20275558 TGGTCTTTACAGAAGAATTCTGG + Intergenic
1192797963 X:74440159-74440181 AGGGTTTTAGAGAGGGAGTAGGG + Intronic
1194056974 X:89147200-89147222 TGTGTTATACAGCAGAAGTGTGG + Intergenic
1195825864 X:108999916-108999938 TAGTTTTTACATAAGATGTAAGG + Intergenic
1196890206 X:120284041-120284063 TGAGACTTACAGAATAAGTAGGG - Intronic
1198674229 X:139115045-139115067 TGGGGTTGACAGGAGAAGTAAGG + Intronic
1201065956 Y:10094149-10094171 TTTGTTTTAAAGAAGATGTAGGG - Intergenic