ID: 956757810

View in Genome Browser
Species Human (GRCh38)
Location 3:72406462-72406484
Sequence CTCCATATGACACTTGTGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 71}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956757810 Original CRISPR CTCCATATGACACTTGTGTC AGG (reversed) Intronic
903110334 1:21127413-21127435 CACCATCTGACAATTATGTCTGG + Intronic
905842158 1:41190730-41190752 CCCCATATCACACTTCTGTAAGG - Intronic
907239576 1:53074147-53074169 CTCCATCTGGCAGATGTGTCAGG - Intronic
907397659 1:54202790-54202812 CTTCATTTGAAAATTGTGTCTGG - Intronic
910712165 1:90193322-90193344 CTCCATATGGCCCCTCTGTCAGG - Intergenic
913147854 1:116009960-116009982 CACCTTATTACACTTGGGTCAGG + Intronic
916869091 1:168893005-168893027 CTCCATGTGTTACTTCTGTCTGG + Intergenic
919494971 1:198253321-198253343 CTCCATACTACACTTGTTTCTGG - Intronic
920115515 1:203618060-203618082 CTCCAGATGACACTGGAGCCTGG - Intergenic
920543279 1:206795124-206795146 CTCCAGCTGGCCCTTGTGTCTGG - Intergenic
1063204420 10:3817234-3817256 CTTGATATGACACATGTGTCAGG + Intergenic
1067348351 10:45454421-45454443 CTCCCTCAGACACGTGTGTCGGG - Intergenic
1067731638 10:48817084-48817106 CTCAATTGGACACTAGTGTCTGG + Intronic
1073919833 10:108445972-108445994 CTCCATAACACACTTTTGTTTGG + Intergenic
1076865257 10:133163438-133163460 GTCCATATGACATCTGTGCCAGG + Intronic
1086265874 11:84997558-84997580 CTCAATATAACATTGGTGTCTGG + Intronic
1087200489 11:95339763-95339785 CTCCTTATGAAACTTGTAACAGG + Intergenic
1092779174 12:11969619-11969641 CTGAAAATGACCCTTGTGTCCGG - Intergenic
1107052182 13:36062901-36062923 TTGCAGATGACACTTGGGTCAGG - Intronic
1110156790 13:72326456-72326478 CTACATATGAGACTTGGGTGGGG + Intergenic
1116089281 14:40284477-40284499 CTACCTATCACACTTGTGTTTGG - Intergenic
1121844103 14:97158206-97158228 CCCCATCTGACACTGGGGTCAGG - Intergenic
1122030197 14:98906407-98906429 CTCCATATGACCATGGTGTTGGG + Intergenic
1122323683 14:100870126-100870148 CTCCACGTGACACTTGAGGCTGG - Intergenic
1122323868 14:100871168-100871190 CTCCACGTGACACTTGAGGCTGG - Intergenic
1122324110 14:100872527-100872549 CTCCAGGTGACACATGAGTCAGG - Intergenic
1124399850 15:29338586-29338608 CTCCATAGGGCACTGGTGTCTGG + Intronic
1142471682 17:166498-166520 CTCCAGATGAGACTTGGGTGGGG - Intronic
1142567284 17:848918-848940 CTCCATACCACACATGTGCCTGG + Intronic
1162101278 19:8340716-8340738 CTCCATTTCCCACTTCTGTCTGG + Intronic
1168452246 19:56475705-56475727 TTCCATATAACACATGGGTCTGG - Intronic
926869447 2:17396882-17396904 CTCCATATGACACTTCTTACTGG + Intergenic
945154929 2:206828482-206828504 CTCAACATGACACTTCTGTCTGG + Intergenic
1174098232 20:48106581-48106603 CTCCATATGTCAGTCATGTCAGG - Intergenic
1176151231 20:63592056-63592078 GTCCATCTGGCACTTGTGGCTGG + Exonic
1176198602 20:63849298-63849320 CTCCAGATGACACCTCTGCCAGG + Intergenic
1182835822 22:33340604-33340626 CTCCATGGGACACCTGTGACGGG + Intronic
1183186912 22:36297097-36297119 CTCGTTATGAAACGTGTGTCAGG + Intronic
949729958 3:7097426-7097448 CTCCATATAATACTTCTTTCAGG - Intronic
956757810 3:72406462-72406484 CTCCATATGACACTTGTGTCAGG - Intronic
956757945 3:72408033-72408055 CTCCGTATGGCATCTGTGTCAGG - Intronic
957840502 3:85662601-85662623 CTGCAAATGATACTTTTGTCAGG + Intronic
964648309 3:158982797-158982819 CTCCAAATGACACACATGTCTGG - Intronic
964765444 3:160174455-160174477 CTCCATCTCACAGTTGTGTGAGG - Intergenic
964955837 3:162354877-162354899 CTCCATATGGCATTTGGGTCAGG + Intergenic
967586938 3:191225467-191225489 GTCAATATGACACTTGTTTCAGG - Intronic
968489308 4:881563-881585 CTCCACACGGCACCTGTGTCAGG + Intronic
970808258 4:20061219-20061241 CTCCAGGTGACCCTTGTGCCTGG - Intergenic
979033711 4:115684529-115684551 CTCCATATTACACTTTTTACAGG - Intergenic
984512426 4:180694549-180694571 CTCAATATGAGATTTGTGTGGGG + Intergenic
986333594 5:6736230-6736252 CTCCAAATGACTCTTTTGGCGGG + Intronic
991140803 5:63240146-63240168 CTCCATATGAAATCTGTGTGTGG + Intergenic
991277424 5:64865914-64865936 CACCATATGACAGATGTGGCTGG - Intronic
992614944 5:78538742-78538764 CTCCATATGATCCCTGTGTGGGG + Intronic
993622102 5:90180600-90180622 CACCATATCAGACTTATGTCTGG + Intergenic
1000603113 5:163298475-163298497 CTCCACAAGACACTTCTATCAGG + Intergenic
1014647148 6:123988195-123988217 TTGCATATGACTTTTGTGTCTGG + Intronic
1020635769 7:10694169-10694191 CTCCAAATGATACTGGTTTCAGG - Intergenic
1022673439 7:32477020-32477042 TTCCATCTGACACCTGTGTTGGG - Intergenic
1023159835 7:37286317-37286339 GCCCATCTGACACTAGTGTCTGG - Intronic
1023464767 7:40441960-40441982 CTTCATATGACTCATGGGTCTGG + Intronic
1029946153 7:104535283-104535305 CTCCAAATGATACTTCTGTCAGG + Intronic
1040577628 8:48667598-48667620 TTCCATATGACATTTGGGTGGGG + Intergenic
1041258354 8:55998687-55998709 CTCCACATGATACTTTTGTTAGG + Intronic
1041723609 8:60998397-60998419 CTTCATATGAAACTTAAGTCGGG - Intergenic
1047034700 8:120924465-120924487 TTACATATGAGACTTGTGTTTGG + Intergenic
1048564609 8:135582046-135582068 CTCCATAAGTCTCTTGTGTCGGG - Exonic
1049919924 9:353646-353668 CTCCATCTGACAGTTCTGTCTGG + Intronic
1050966212 9:11806411-11806433 CTCCTAATGGCACTTATGTCTGG - Intergenic
1052340403 9:27359345-27359367 CTCCCTATGACTCCTGTGACGGG - Intronic
1055511345 9:76998634-76998656 CTCCAAGTCACAGTTGTGTCTGG - Intergenic
1058168802 9:101653150-101653172 CATCACATGCCACTTGTGTCAGG + Intronic
1059468062 9:114482008-114482030 GTCCTTATGACACTTGAGCCTGG + Intronic
1059711457 9:116871472-116871494 CTCCCAATGACCCTTGTGTTGGG + Intronic
1060815908 9:126635043-126635065 CTTCATATGGCGCTTGTGCCTGG - Intronic
1188441208 X:30216467-30216489 CTCTATATGGCACTTCTTTCTGG - Intronic
1188866436 X:35318905-35318927 CTCTATAGGACACTAGTGTCAGG - Intergenic
1194673933 X:96770410-96770432 CGTAATATTACACTTGTGTCAGG + Intronic
1195072561 X:101294232-101294254 CTCCCTGAGACACTTTTGTCAGG - Intergenic
1195771106 X:108352467-108352489 CTCCATATGGGACTTGTTTGTGG - Intronic
1197333772 X:125186420-125186442 CTCAATATGTGACTTGTGGCAGG - Intergenic
1201859569 Y:18581815-18581837 TTCCATTTGACACCTGTGGCTGG - Intronic
1201873752 Y:18738566-18738588 TTCCATTTGACACCTGTGGCTGG + Intronic