ID: 956757945

View in Genome Browser
Species Human (GRCh38)
Location 3:72408033-72408055
Sequence CTCCGTATGGCATCTGTGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 73
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 66}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956757945 Original CRISPR CTCCGTATGGCATCTGTGTC AGG (reversed) Intronic
902652427 1:17845345-17845367 CTCCATGTGGCCTCTGAGTCAGG + Intergenic
904707796 1:32404586-32404608 CTCCCTCTGGCTTCTGTGTAAGG + Intergenic
904927751 1:34061985-34062007 CTGTGTATGGGATCTGTGTATGG + Intronic
907239576 1:53074147-53074169 CTCCATCTGGCAGATGTGTCAGG - Intronic
910712165 1:90193322-90193344 CTCCATATGGCCCCTCTGTCAGG - Intergenic
915792093 1:158683596-158683618 CTCTTTATGGCCTCTGAGTCTGG - Intronic
1068450281 10:57177739-57177761 TTTCTTATGGCATCTTTGTCTGG - Intergenic
1074900064 10:117808536-117808558 CACCGTGTTGCATCTGTCTCTGG - Intergenic
1076865257 10:133163438-133163460 GTCCATATGACATCTGTGCCAGG + Intronic
1080032423 11:27675930-27675952 CTCAGTATGGCTTGTGGGTCTGG - Intronic
1088682386 11:112254593-112254615 GTGCGTATGGCATGTGTGTATGG + Intronic
1091204509 11:133810447-133810469 CTCAGTATGGCAGCTGTCCCAGG - Intergenic
1095970796 12:47900901-47900923 CTTTGTATGGCATCTGGTTCTGG + Intronic
1104339336 12:127932583-127932605 CTCCGTAGGACCTCTCTGTCTGG - Intergenic
1116794116 14:49371545-49371567 CTCCGTAAGGAATGTGTCTCAGG - Intergenic
1128426465 15:67546378-67546400 CTGCTTCTGGCATCTGTGTCAGG - Intronic
1136078246 16:27831662-27831684 CACCGCATAGCATCTGTTTCTGG - Intronic
1141811551 16:86379431-86379453 CACCTTATGGCATCTGTGTCTGG - Intergenic
1146570164 17:33945628-33945650 CTGCATATGGCTTCTGTGTCAGG + Intronic
1146572969 17:33968659-33968681 CTCCGTTGGGCTTCTGGGTCAGG + Intronic
1152925277 17:83084791-83084813 GTCCGTGTGGCACCTGTGGCCGG + Intronic
1157137419 18:45070240-45070262 CTCCCTATTGCATGTGTGACAGG - Intergenic
1164708061 19:30335070-30335092 CTCCGTACAGCATCTGGGGCTGG + Intronic
925345933 2:3171806-3171828 CTCCGTGGGGCACATGTGTCGGG - Intergenic
928658591 2:33478305-33478327 CTCGGTATGGCATTTGTGTGAGG + Intronic
930965444 2:57318397-57318419 CACGGCATGGCATATGTGTCAGG + Intergenic
932631554 2:73347812-73347834 CTCCCCATGGCATCTGAATCAGG - Intergenic
940910083 2:159202794-159202816 ATGCTTATGGCATCTGTTTCAGG + Intronic
943406384 2:187493033-187493055 CCCAGTAGGGAATCTGTGTCGGG + Intronic
944984384 2:205158630-205158652 CTACTGATTGCATCTGTGTCTGG + Intronic
945117420 2:206421737-206421759 CTCCATATGGCCTCTCTGTGTGG + Intergenic
948292140 2:236833506-236833528 CTGCTAATGGCATCTCTGTCTGG - Intergenic
948483002 2:238262101-238262123 CTCCCTATGCCATCTGTTGCTGG + Intronic
1171449662 20:25226601-25226623 CTCAGTGTGGCGTCAGTGTCGGG + Exonic
1178272518 21:31204918-31204940 CGGTGAATGGCATCTGTGTCTGG - Intronic
1180152699 21:45959821-45959843 CTCAGGATGGACTCTGTGTCTGG - Intergenic
1184968261 22:47996876-47996898 CTCTGCATGGCTTCTGTGCCTGG + Intergenic
1185088256 22:48752354-48752376 CTGTGTATGGCACCTGTGTGGGG - Intronic
956757810 3:72406462-72406484 CTCCATATGACACTTGTGTCAGG - Intronic
956757945 3:72408033-72408055 CTCCGTATGGCATCTGTGTCAGG - Intronic
957661185 3:83155713-83155735 CTTTGAATGGCATCTGTCTCAGG - Intergenic
962191487 3:133315525-133315547 CTCTTTATGGAATCTGTGTTTGG - Intronic
963837760 3:150074215-150074237 ATCCCTCTGGCATCTGTGGCAGG + Intergenic
964955837 3:162354877-162354899 CTCCATATGGCATTTGGGTCAGG + Intergenic
968489308 4:881563-881585 CTCCACACGGCACCTGTGTCAGG + Intronic
970196631 4:13557389-13557411 CTCCTTATGGCAACAGTTTCCGG - Intergenic
971793633 4:31199506-31199528 CCCAGTATGGCCTCTGTGTGGGG + Intergenic
978263148 4:106787901-106787923 CTACGTATAGCATCTGTGGTTGG + Intergenic
978993316 4:115115048-115115070 CTCTGTATGGCATATGTCTATGG - Intergenic
985365503 4:189227388-189227410 CTCCCCATCGAATCTGTGTCTGG + Intergenic
989255468 5:39362027-39362049 GTCCTTATGACATCTGTGCCTGG - Intronic
990776444 5:59310475-59310497 CTCCATAGGGCATCTGTATGTGG + Intronic
991140803 5:63240146-63240168 CTCCATATGAAATCTGTGTGTGG + Intergenic
992146286 5:73852825-73852847 CTCCCTCTGGGATCTGTATCAGG + Intronic
993408552 5:87544971-87544993 CTCCTCCTGGCATCTGTGCCTGG - Intergenic
996126519 5:119731499-119731521 TTCAATATGGCTTCTGTGTCAGG - Intergenic
996623409 5:125538523-125538545 TTCCCTGTGGCATCTTTGTCTGG - Intergenic
999919797 5:156305585-156305607 CTCAGTAGGGCCTCTGTGTGGGG - Intronic
1002086616 5:176779944-176779966 CTCCGTGTGGCACCTGTGACAGG + Intergenic
1002464389 5:179398982-179399004 CACCCTATTGCATCTGTGGCAGG - Intergenic
1011785101 6:90835015-90835037 ATCAGTATGGCATCTGTATATGG - Intergenic
1013089379 6:106885951-106885973 CTGCCTAAGGCATCTGTTTCAGG + Intergenic
1024265872 7:47606118-47606140 CCTCGTATGGCATCTTTGCCTGG + Intergenic
1030815130 7:114026116-114026138 CTCCTTCTGGCAGCTGTGACTGG + Intronic
1031144334 7:117981177-117981199 CTTGGTATGGCATGTGTGTAGGG + Intergenic
1031807920 7:126329476-126329498 CCCAGTATGGACTCTGTGTCGGG - Intergenic
1035150844 7:156871471-156871493 CTTCTTATGGCTTCTTTGTCTGG - Intronic
1047089755 8:121560776-121560798 CTTCGTCTGGCTGCTGTGTCTGG - Intergenic
1050818179 9:9841785-9841807 GTCCTTATGGCATGTGTGTATGG - Intronic
1059738357 9:117124828-117124850 CTGCATGTGGCATCTGTGCCAGG + Intronic
1062250339 9:135590722-135590744 CTCCCTATGGCCTCTGTTCCTGG - Intergenic
1192528291 X:71866797-71866819 CTCTGTCTGGCATGTGTGTGAGG + Intergenic
1193907908 X:87264851-87264873 CTCCATAGGGCATCTGTCTGTGG - Intergenic