ID: 956760349

View in Genome Browser
Species Human (GRCh38)
Location 3:72437648-72437670
Sequence CTAAATTGACAGAGGGAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 329
Summary {0: 1, 1: 0, 2: 1, 3: 32, 4: 295}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956760340_956760349 26 Left 956760340 3:72437599-72437621 CCTTCCACTAGTTTCTTTTCCCA 0: 1
1: 0
2: 2
3: 37
4: 353
Right 956760349 3:72437648-72437670 CTAAATTGACAGAGGGAGAAAGG 0: 1
1: 0
2: 1
3: 32
4: 295
956760343_956760349 7 Left 956760343 3:72437618-72437640 CCCAACCACAGGACAATTTAAGT 0: 1
1: 0
2: 0
3: 17
4: 176
Right 956760349 3:72437648-72437670 CTAAATTGACAGAGGGAGAAAGG 0: 1
1: 0
2: 1
3: 32
4: 295
956760344_956760349 6 Left 956760344 3:72437619-72437641 CCAACCACAGGACAATTTAAGTA 0: 1
1: 0
2: 0
3: 12
4: 185
Right 956760349 3:72437648-72437670 CTAAATTGACAGAGGGAGAAAGG 0: 1
1: 0
2: 1
3: 32
4: 295
956760341_956760349 22 Left 956760341 3:72437603-72437625 CCACTAGTTTCTTTTCCCAACCA 0: 1
1: 0
2: 2
3: 24
4: 264
Right 956760349 3:72437648-72437670 CTAAATTGACAGAGGGAGAAAGG 0: 1
1: 0
2: 1
3: 32
4: 295
956760345_956760349 2 Left 956760345 3:72437623-72437645 CCACAGGACAATTTAAGTAGATT 0: 1
1: 0
2: 2
3: 13
4: 221
Right 956760349 3:72437648-72437670 CTAAATTGACAGAGGGAGAAAGG 0: 1
1: 0
2: 1
3: 32
4: 295

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956760349 Original CRISPR CTAAATTGACAGAGGGAGAA AGG Intronic
900230905 1:1556921-1556943 CTGAGATGACAGAGGTAGAACGG - Intronic
901264309 1:7898403-7898425 CAAGATGGACAGAGAGAGAAGGG + Intergenic
902309355 1:15568987-15569009 TAAAATCGACAGAGGCAGAAAGG - Exonic
902720248 1:18299473-18299495 GAAAATATACAGAGGGAGAAGGG - Intronic
904605219 1:31694500-31694522 CTGGATTGAAAGAGGGAGCAGGG + Intronic
908546196 1:65164428-65164450 TAAAATTGAAAGAGAGAGAAAGG - Intronic
908859143 1:68463724-68463746 CTGATTTAACAGAGGGAGGAGGG - Intergenic
909512217 1:76466452-76466474 CTAATTTGACAGATGTAAAATGG - Intronic
909741061 1:79030172-79030194 TTAAATTGACAAAAGGAAAACGG + Intergenic
910509037 1:87983263-87983285 ATATATAGACAGAGGTAGAATGG - Intergenic
910607455 1:89102473-89102495 CTAAATTGAGAGGTGGAAAATGG + Intergenic
912453427 1:109782206-109782228 CTAATTTGACAGATGAAAAATGG + Intergenic
913469488 1:119174544-119174566 TTTAAATCACAGAGGGAGAAGGG - Intergenic
915305079 1:154972661-154972683 TGAAATTTACATAGGGAGAAAGG + Intronic
916413623 1:164572585-164572607 CTAGTGTGACAGAGGGAGCATGG + Intronic
918217666 1:182407138-182407160 CTAAATTGAGAGAGAGAACAGGG + Intergenic
919276703 1:195427563-195427585 CTAAAGAGAGGGAGGGAGAAAGG - Intergenic
919761465 1:201100647-201100669 CTGACTAGACAGAGGGACAATGG + Intronic
920133194 1:203748699-203748721 CTCATTTGAAAGAGGGAGTAAGG + Intergenic
921019673 1:211224434-211224456 TTTAAATCACAGAGGGAGAAGGG - Intergenic
923649419 1:235859658-235859680 CTAGATTGTCTGAGGGTGAATGG - Intronic
1063024155 10:2161469-2161491 TTAAATTGAATGAGGGAGAATGG + Intergenic
1064500616 10:15968857-15968879 CTGAATTGAGGGAGGCAGAAAGG - Intergenic
1067009586 10:42697961-42697983 AGAAAGAGACAGAGGGAGAAGGG - Intergenic
1067668453 10:48298983-48299005 CAAAATTTACACAGGGAGCAAGG - Intergenic
1068173864 10:53430824-53430846 CTAAATTGACAGAGCTGGAATGG + Intergenic
1069024722 10:63527339-63527361 CTAAAGAGACAGAGGGAAATGGG - Intronic
1069314244 10:67077894-67077916 CTAGATTAACAGAGGAGGAAGGG + Intronic
1070060552 10:72979189-72979211 CTAAAATAACAGAGGAAGTAAGG - Intergenic
1070456833 10:76625381-76625403 CTAAAAGGACAGAGTGAGGAGGG + Intergenic
1071153243 10:82660744-82660766 ATAAATTGACAGAAAAAGAATGG - Intronic
1071245655 10:83759641-83759663 CTAAATGGATAGAAAGAGAAAGG - Intergenic
1074718188 10:116240003-116240025 AGCAATTCACAGAGGGAGAAAGG + Intronic
1075984608 10:126773688-126773710 CTAAAATGACTGAGGGACATTGG - Intergenic
1077312124 11:1893557-1893579 ATGAATGGACAGAGGGAGAGAGG + Intergenic
1077386867 11:2273555-2273577 ATAAATTCACAGAGACAGAAAGG + Intergenic
1078558061 11:12346891-12346913 CTAAAGTGAGAAAGGGAGGAGGG - Intronic
1079289051 11:19169869-19169891 CTAAATCTGCAGAGGAAGAAAGG - Intronic
1079363301 11:19787786-19787808 CAAAATTTAGAGTGGGAGAAAGG + Intronic
1085719443 11:78899951-78899973 CTAAATGGACTGAGACAGAAGGG + Intronic
1087270326 11:96104788-96104810 CTAGATTGAAAGAAGGAGAAGGG + Intronic
1088339984 11:108753520-108753542 CACGATGGACAGAGGGAGAACGG - Intronic
1088516938 11:110647032-110647054 GTAACTTGAGAGAGAGAGAATGG + Intronic
1089055416 11:115581070-115581092 GTAGATTAAAAGAGGGAGAAAGG - Intergenic
1090691330 11:129185654-129185676 TTAAACTGACGGAGGCAGAATGG + Intronic
1091035255 11:132227367-132227389 TTAATTAGAAAGAGGGAGAATGG + Intronic
1091080222 11:132659463-132659485 CTAAATTGAGACAGAGTGAAGGG + Intronic
1091878089 12:3953741-3953763 CCAAATTAATAGAGGGAAAAGGG - Intergenic
1091949310 12:4580016-4580038 CTCATTTTACAGATGGAGAAAGG - Intronic
1092754854 12:11753665-11753687 CTGAATTACCAGAGAGAGAAAGG - Intronic
1092826452 12:12404417-12404439 CTCAACTGGCAGAAGGAGAATGG + Intronic
1094045183 12:26159175-26159197 ACAGATTGACAGAGGGTGAAGGG + Intronic
1095994536 12:48069212-48069234 CCAAGTAGACAGAGAGAGAAAGG + Intronic
1096245855 12:49985737-49985759 CAAGAGTTACAGAGGGAGAAAGG + Intronic
1096765816 12:53888333-53888355 ATTAATTGGCAGAGGCAGAATGG + Intergenic
1100176146 12:92033144-92033166 CAGAATTGAAAAAGGGAGAAGGG + Intronic
1101244892 12:102875945-102875967 ATATATAGACAGAGCGAGAAAGG + Intronic
1101984343 12:109433854-109433876 ATAAATTGAAACAGGGACAAGGG + Intronic
1102371091 12:112382571-112382593 CTGAATGGCCAGGGGGAGAAGGG - Intergenic
1102543828 12:113640731-113640753 GTAAATTGACAGGGGGTGGAGGG - Intergenic
1103047379 12:117748762-117748784 CTAAATTAAGACAGGGATAAAGG - Intronic
1103152384 12:118652001-118652023 CTAAGCAGAGAGAGGGAGAAGGG + Intergenic
1104427993 12:128693806-128693828 CTGCAAAGACAGAGGGAGAAAGG - Intronic
1104752677 12:131250056-131250078 CTTATTTCCCAGAGGGAGAAGGG - Intergenic
1105211106 13:18257673-18257695 GTAAATCGTCAGAGGCAGAAAGG + Intergenic
1106826924 13:33533037-33533059 CTAAGTGGCCAGTGGGAGAAAGG + Intergenic
1107335405 13:39349451-39349473 ATAAATTGAGAGAGGGAGCGAGG - Intronic
1107462412 13:40616845-40616867 CAAAAGGGACAGATGGAGAAAGG + Intronic
1108200261 13:48036504-48036526 GCATATTAACAGAGGGAGAAAGG - Intergenic
1109200057 13:59420379-59420401 CAGAGTTGACAGAGGTAGAAGGG + Intergenic
1109682278 13:65768589-65768611 ATACATAGACAGAGGGAGAGGGG + Intergenic
1111059596 13:82998774-82998796 CTTAAGTGACAGAGGAAAAATGG - Intergenic
1111233865 13:85382284-85382306 ATTAATTTAGAGAGGGAGAAAGG - Intergenic
1111280657 13:86018943-86018965 ATGAAATGACAGAGGGAGAAAGG + Intergenic
1111973624 13:94942741-94942763 CCAAGCTGACAGAGGAAGAATGG + Intergenic
1111982904 13:95035652-95035674 GGAAATTGAAAGAGGGAGGAAGG + Intronic
1112199689 13:97262574-97262596 CAAAAATAAGAGAGGGAGAAGGG - Intronic
1113164934 13:107429427-107429449 CTAAAATAATGGAGGGAGAATGG + Intronic
1113203938 13:107895080-107895102 TTAAATCAAGAGAGGGAGAAGGG + Intergenic
1113334835 13:109367781-109367803 CTAAATGCACACAGGGAGAATGG + Intergenic
1113433129 13:110267313-110267335 CAAGAAGGACAGAGGGAGAACGG + Intronic
1113668422 13:112157949-112157971 CCAAATTAACAGAGGAAAAATGG - Intergenic
1114816630 14:25966531-25966553 CTAAAATGAGAGGGAGAGAAAGG + Intergenic
1115374375 14:32657153-32657175 CTGATTTGACATAGGGAAAAAGG + Intronic
1116625269 14:47255205-47255227 GTAAATTGACAAAGGGAAAAAGG + Intronic
1118949806 14:70425841-70425863 CTAAATTTAGAGAGGGAAAGAGG + Intergenic
1119624582 14:76161593-76161615 CAAAATTGCCAGGGGGAGCAGGG - Intronic
1119692240 14:76683696-76683718 ATAAATGGACAGAGAGAAAAGGG - Intergenic
1121596616 14:95168208-95168230 CAGAATAAACAGAGGGAGAAGGG - Intergenic
1121998709 14:98628032-98628054 CTAAAGTCTCAGAGGGAGCATGG + Intergenic
1122391592 14:101391823-101391845 CTAAAATCACAGAAAGAGAAGGG - Intergenic
1122573927 14:102728809-102728831 TTTATTTGACAGAGGGAAAATGG + Exonic
1123185281 14:106510898-106510920 CCAAACTGACAGAGTGGGAAAGG - Intergenic
1126195499 15:45926255-45926277 ATACATTGCCAGAGAGAGAACGG - Intergenic
1127221231 15:56883848-56883870 CTGAATTGGGAGAGGGTGAAAGG - Intronic
1127845470 15:62866621-62866643 CCAAATTCACACAGGGAGGAAGG - Intergenic
1128342109 15:66829853-66829875 TTAAATTGACAGATGGTGGAGGG + Intergenic
1128608706 15:69057226-69057248 ATAAATTGACAGATGGAAAGAGG - Intronic
1129044020 15:72717283-72717305 CTCAATTGACACAAAGAGAAGGG - Intronic
1131806997 15:96133224-96133246 CTAAATTGACAAAATGGGAATGG + Intergenic
1131990030 15:98084177-98084199 CTAAAAAGAAAGAGGCAGAATGG + Intergenic
1133455209 16:5935877-5935899 CTGAATTCACAGAGGTATAATGG + Intergenic
1133777298 16:8907028-8907050 CAAAATTAACAGAGGCAGGAAGG + Intronic
1134883807 16:17772041-17772063 TTAAATTGACTCTGGGAGAAGGG + Intergenic
1135013574 16:18905298-18905320 TTAGATTGATAGAGGGAGAAAGG - Intronic
1135320513 16:21492865-21492887 TTAGATTGATAGAGGGAGAAAGG - Intergenic
1135373348 16:21924355-21924377 TTAGATTGATAGAGGGAGAAAGG - Intergenic
1135438441 16:22446347-22446369 TTAGATTGATAGAGGGAGAAAGG + Intergenic
1136330731 16:29574570-29574592 TTAGATTGATAGAGGGAGAAAGG - Intergenic
1136445366 16:30314286-30314308 TTAGATTGATAGAGGGAGAAAGG - Intergenic
1140193267 16:72836204-72836226 CGAAAGTCACAGAGGGAGAATGG - Intronic
1144678393 17:17176403-17176425 CTAAAATGACAGAGAGATCAGGG - Intronic
1146321849 17:31853031-31853053 CTAAATTGACAAAGAGAAGATGG + Intronic
1149191180 17:54064734-54064756 GTAAATTGAAACAGGGAAAATGG - Intergenic
1149256149 17:54829000-54829022 ATAAAGTCACAGAAGGAGAATGG + Intergenic
1153367793 18:4277771-4277793 ATAAAGTGACAGTGGGAGATAGG - Intronic
1155293935 18:24368590-24368612 CTAAAGGGATAGAGGGAGACAGG + Intronic
1156182208 18:34618558-34618580 CAAAAATGACATAGGCAGAAAGG - Intronic
1156371887 18:36478540-36478562 CTACATTGGCAGAGGGAGTGGGG - Intronic
1156512873 18:37655753-37655775 CTGAGTTGAGAGAAGGAGAAGGG - Intergenic
1159286996 18:66366722-66366744 CTTTATTAACAGAGTGAGAATGG + Intergenic
1160566896 18:79791645-79791667 CAAAATTGACAGAGACAGAAAGG + Intergenic
1164992968 19:32697865-32697887 TTAAAATCAGAGAGGGAGAAGGG + Intronic
1165024952 19:32953778-32953800 CCAAATTGGCAGAGTGAGATGGG - Exonic
1165163745 19:33835226-33835248 CAAGATTGACAGAGAGAAAAAGG + Intergenic
1166034615 19:40158764-40158786 CCAAATTTACATAGAGAGAAGGG + Intergenic
1166161374 19:40956029-40956051 CTAAATTGACAGATGGTAATGGG + Intergenic
1166449513 19:42886233-42886255 ATAAATGAAAAGAGGGAGAAGGG - Intronic
1166460811 19:42986526-42986548 ATAAATGAAAAGAGGGAGAAGGG - Intronic
1166478106 19:43146516-43146538 ATAAATGAAAAGAGGGAGAAGGG - Intronic
1166734222 19:45075258-45075280 CAGAATTGACAGAGAGAGACAGG + Intronic
1168123693 19:54271101-54271123 TAAAATTGAAAGAGGGAGAGGGG - Intronic
1168178659 19:54644420-54644442 TGAAATTGAAAGAGGGAGAGGGG + Intronic
926806065 2:16712335-16712357 CTAAAATGTCAGAGTCAGAAGGG - Intergenic
928161588 2:28931440-28931462 CTAAATTGCAAGAGACAGAAGGG - Intronic
928390936 2:30910515-30910537 CTACATTGAGAGATGAAGAATGG - Exonic
930485819 2:52009442-52009464 AGAAAGAGACAGAGGGAGAAAGG - Intergenic
930850346 2:55953142-55953164 ATAAATTGTCTGAGGGAGAGAGG - Intergenic
930989584 2:57636573-57636595 CTAAAGAGACAAAGAGAGAAAGG + Intergenic
931087963 2:58854817-58854839 CTAGATTCCCAGAGGCAGAAGGG - Intergenic
931108195 2:59080887-59080909 CTAGACAGACAGAGAGAGAAAGG + Intergenic
932038751 2:68276217-68276239 CTGAAGTGGCAGAGAGAGAATGG + Intergenic
932445017 2:71775067-71775089 CTAAATTGGGAGAGGAAGAATGG - Intergenic
932803368 2:74762357-74762379 GAAAATTGAGAAAGGGAGAAGGG - Intergenic
933229426 2:79789349-79789371 TTAAAGTGCCAGAGGGAGAATGG + Intronic
935300895 2:101693213-101693235 CTCCATTGACAGAGGGAGGGAGG - Intergenic
936375748 2:111939971-111939993 CTGATTAGACAGAGGCAGAAGGG - Intronic
937098005 2:119248222-119248244 CTGAGTTGCCAGAGGGAGGAAGG - Intronic
938580117 2:132638120-132638142 AAAAAGAGACAGAGGGAGAAAGG + Intronic
939393332 2:141597329-141597351 CTAAATTCTCATAGGGAGTAGGG - Intronic
939445698 2:142307523-142307545 ATTAATTGACACAGGAAGAAAGG + Intergenic
941051016 2:160734313-160734335 GTTAATTAATAGAGGGAGAAGGG - Intergenic
943356368 2:186861087-186861109 CTAAATTTTCAGACTGAGAAAGG - Intergenic
944213777 2:197233477-197233499 CAAAATTAACAAAGGGACAAAGG + Intronic
945505641 2:210637148-210637170 CTAAATTTAGAGAGGGAGAGAGG + Intronic
946027689 2:216681714-216681736 CTAAAATGACAGCTGGAAAAGGG - Intronic
946130440 2:217602296-217602318 CTAATATGACAGAGTGAGACAGG - Intronic
946324026 2:218973914-218973936 CTAAAGTCACACAGTGAGAAAGG - Intergenic
947332944 2:229049211-229049233 CTAATTTGACAGATGAAAAATGG + Intronic
947353084 2:229266859-229266881 CCAAATTGACAAAAGGAGCAAGG - Intronic
1170045440 20:12080403-12080425 CTAAATCCACTGAGGGAGAGGGG - Intergenic
1170346960 20:15397914-15397936 CTAAATTGGCCCACGGAGAAGGG - Intronic
1171169416 20:23001966-23001988 GTAAATTGAGAGAATGAGAAGGG + Intergenic
1172944539 20:38676993-38677015 CTCAATGGGCAGAGGCAGAATGG - Intergenic
1173143475 20:40505067-40505089 CTAAATTTACAGATGCAGATAGG - Intergenic
1174503347 20:51001427-51001449 CTCACTTGAGAGAGGGACAAAGG - Intergenic
1174706228 20:52658999-52659021 CTAAGTTGAAGGAAGGAGAAAGG + Intergenic
1174823890 20:53751353-53751375 CTAAAGTCAGAGAGAGAGAACGG - Intergenic
1175453942 20:59095527-59095549 GTAAAGTGAGAGAGGGAGAAGGG - Intergenic
1179026601 21:37683818-37683840 GTGAAGTGGCAGAGGGAGAAAGG + Intronic
1179593852 21:42429197-42429219 CTAGAATGTCAGAGGGAGCATGG + Intronic
1181371906 22:22425545-22425567 CTAAATAGAGACAGGGAGACAGG - Intergenic
1181908733 22:26220829-26220851 ATGAATTGAGAGAAGGAGAAAGG + Intronic
1183208593 22:36435852-36435874 CTAATTTGACAGACGAGGAAAGG - Intergenic
1183487306 22:38095848-38095870 CTAAATTAATAAAGGGAAAAGGG + Intronic
1183781321 22:40000852-40000874 TTAAATTCACAGAGCAAGAAGGG + Intronic
1183788699 22:40047215-40047237 TTGAATTATCAGAGGGAGAAAGG + Intronic
949996723 3:9623117-9623139 CTACAGTTACAGAGGGAGCATGG + Intergenic
951388184 3:22068597-22068619 CTAAATAGACAGAGTGTGGATGG - Intronic
951656420 3:25013989-25014011 CAAAGTTGAGAGAGGGAGAAGGG - Intergenic
951962639 3:28346644-28346666 CTAACTTTTCAGAGGTAGAAAGG - Intronic
952288941 3:31996488-31996510 ATAAATTGCCAGGGGGAGAAGGG + Intronic
952990285 3:38825626-38825648 CTAAATGGACAGAGGAAATACGG + Intergenic
953372302 3:42399243-42399265 CTAAACTGCCACTGGGAGAAGGG - Intronic
953551465 3:43906896-43906918 CTAGAGTGACAAAAGGAGAAAGG + Intergenic
953622973 3:44548684-44548706 CTTAAATCAGAGAGGGAGAAGGG + Intergenic
954952855 3:54490474-54490496 CTAAATTGCCAGGGAGAGAGTGG + Intronic
955420800 3:58735205-58735227 CCAAATTAACAAAGGGAGAAAGG - Intronic
956027967 3:65003933-65003955 GGAACTTGACAGAGAGAGAAAGG - Intergenic
956760349 3:72437648-72437670 CTAAATTGACAGAGGGAGAAAGG + Intronic
957938425 3:86973728-86973750 CTAAATAGTCAAATGGAGAAAGG - Intronic
958596455 3:96231617-96231639 CTAGATTTAAAGATGGAGAATGG - Intergenic
958601360 3:96300012-96300034 CTTAAGTCAGAGAGGGAGAAAGG - Intergenic
959397829 3:105863701-105863723 CTAAATAGACTGAGGGCAAAAGG + Intronic
959525678 3:107373621-107373643 TCATATTGAAAGAGGGAGAAAGG + Intergenic
959596173 3:108131172-108131194 CTAAGTTGTCAGAGGTGGAATGG - Intergenic
960503786 3:118468900-118468922 CTAAAATGAGAGAGTTAGAATGG + Intergenic
961087786 3:124084055-124084077 CTAAATGGGGAGAAGGAGAAAGG + Intronic
961206184 3:125083765-125083787 CCAAAGTGACAGCGGGAGGATGG + Exonic
962358203 3:134713191-134713213 CCAAAAAGAAAGAGGGAGAATGG - Intronic
962699889 3:137987389-137987411 CTAAATAAACAGTGGGAGAAAGG + Intergenic
962779109 3:138694460-138694482 CAAAATTTAAAGAGGGAAAAAGG - Intronic
964064465 3:152562047-152562069 CTTAAATCAGAGAGGGAGAAGGG - Intergenic
964314054 3:155424635-155424657 CTAAATATACAGATGGACAATGG + Intronic
965252270 3:166357040-166357062 CTAAACTGGCAAAGGTAGAATGG - Intergenic
965742701 3:171892595-171892617 CTGAATTTCCAGATGGAGAAAGG - Intronic
966403583 3:179571573-179571595 CAAAATCGACAAAGGGAAAAGGG + Intronic
973201595 4:47509363-47509385 CATTATTGACTGAGGGAGAAAGG + Intronic
973831896 4:54769908-54769930 CTAGATGGAGAGTGGGAGAATGG - Intergenic
975082359 4:70296373-70296395 CTAACTTGAGGGAGGGGGAAGGG + Intergenic
975126671 4:70790267-70790289 CTAAGTTGCCAGAGAGAAAATGG - Intronic
976346023 4:84002503-84002525 ATAACATGACAGAGGAAGAAAGG - Intergenic
976872532 4:89812764-89812786 ATAAAAAGAAAGAGGGAGAAGGG + Intronic
977161183 4:93638173-93638195 ATAAAATGACAGAAGCAGAATGG - Intronic
978601612 4:110434005-110434027 CTAAAAGGAGAGAGGGAGAGGGG - Intronic
978747139 4:112207685-112207707 TTTAATTCAGAGAGGGAGAAGGG - Intergenic
978784237 4:112591720-112591742 CTGAATGAAGAGAGGGAGAAAGG - Intronic
979211036 4:118103392-118103414 CAGAATTGAGAGAGGAAGAAGGG + Intronic
979728648 4:123995157-123995179 CCAAATTGACAGAGAGAAATGGG - Intergenic
980784821 4:137538500-137538522 TTAAATTCACAGAAAGAGAAGGG + Intergenic
981141996 4:141279279-141279301 TTAGGCTGACAGAGGGAGAAGGG + Intergenic
981654347 4:147096113-147096135 ATATATAGACAGAGAGAGAAAGG + Intergenic
981689140 4:147487023-147487045 CAAATATGGCAGAGGGAGAAGGG + Intronic
982194801 4:152900150-152900172 AGAAAATGAGAGAGGGAGAAGGG + Intronic
982988551 4:162242027-162242049 CTAAATTCACAAAGAGAGCAAGG - Intergenic
983569430 4:169188785-169188807 CCAAATTGATAGAGGGAGTATGG - Intronic
984826036 4:183925287-183925309 CCAAATTGAAAGAGGTACAACGG + Intronic
985349368 4:189040901-189040923 GTAAAGAGACAGAGGGAGAGTGG - Intergenic
986274781 5:6264078-6264100 CTTTATTAACAGAGTGAGAATGG + Intergenic
986923734 5:12719395-12719417 CTAAATTCAAAGAGTGTGAAGGG - Intergenic
987161704 5:15151502-15151524 ATAAATTGACAGAAATAGAATGG - Intergenic
987545286 5:19305085-19305107 CTTAAATCAGAGAGGGAGAAGGG + Intergenic
988123607 5:26999591-26999613 CTCATTTGACAAAGGGACAAAGG + Intronic
991266393 5:64724226-64724248 ATATATTGCCAGAGGGATAATGG + Exonic
992150260 5:73895543-73895565 CTGAAGTGACAGTGGGACAAAGG + Intronic
992214580 5:74513754-74513776 AGAAAATGACAGAGGGACAAGGG + Intergenic
992687041 5:79209215-79209237 CTGAAATGAGAGAGAGAGAAGGG + Intronic
993132613 5:83918292-83918314 CTAAATTTACCCTGGGAGAAAGG + Intergenic
995682207 5:114732277-114732299 CCAAATTGTCAGAGAGAGGATGG - Intergenic
996306790 5:122056118-122056140 GTCAAATGAGAGAGGGAGAATGG - Intronic
996339527 5:122421225-122421247 CTAAAATGTCAGAGCCAGAAAGG + Intronic
996349190 5:122519675-122519697 CTCAAGTGACTGAGGGATAATGG - Intergenic
998674512 5:144391996-144392018 GTGAATTTACAGAGGAAGAAAGG + Intronic
999008595 5:148009336-148009358 TTAAAGTGATAGAGGTAGAAGGG - Intergenic
999389222 5:151178072-151178094 CTAAATGGGTAGAGGGTGAATGG - Intergenic
1001633862 5:173196071-173196093 GTGAGTTGTCAGAGGGAGAAAGG + Intergenic
1001698522 5:173690242-173690264 AGAAATTGACACAGGCAGAATGG - Intergenic
1001701466 5:173709749-173709771 CCCCATTGACAGAGGGAGAAAGG - Intergenic
1004474188 6:15955932-15955954 CAAAAGGGACAGAGGAAGAAAGG - Intergenic
1004519217 6:16346498-16346520 CTAAATGCAAAGAGGGAGCAAGG - Intronic
1004616074 6:17290414-17290436 ATAAATTGCAAGAGTGAGAATGG + Intronic
1004953808 6:20704542-20704564 AGAAAGTGCCAGAGGGAGAATGG + Intronic
1005522004 6:26609967-26609989 CTAAATGGGCAGAGAGAGGATGG + Intergenic
1007027438 6:38591108-38591130 CCAATTTGAGAGAGGGAGAGTGG - Intronic
1008557639 6:52689815-52689837 ATATATTGCCAGAGGGATAATGG - Intergenic
1008764417 6:54893897-54893919 CAAAATGGACAGAAGTAGAATGG - Intronic
1010002733 6:70964184-70964206 ATAAATTGATAGAGGAATAAAGG - Intergenic
1010391885 6:75347089-75347111 TTCAATGCACAGAGGGAGAAAGG - Intronic
1011575810 6:88797787-88797809 ATAGAATGACAGAAGGAGAAAGG + Intronic
1012316326 6:97785488-97785510 CTAATTTTACAGAGGGTAAAAGG + Intergenic
1013496940 6:110706916-110706938 CCAAATTGACAAAGGGAAAGAGG - Intronic
1013907896 6:115238908-115238930 TTTAAATCACAGAGGGAGAAGGG + Intergenic
1014319537 6:119909426-119909448 CTAAATTAGCAGAGGTAGAAGGG - Intergenic
1014992387 6:128097242-128097264 ATAAAGTGACAGAGGGTGGATGG + Intronic
1015672948 6:135711237-135711259 CTAAATAGAGAGAATGAGAAGGG + Intergenic
1019198257 6:170295055-170295077 CAAAACTGACGGAAGGAGAATGG - Intergenic
1020464438 7:8461215-8461237 GTAATGTGACAGAGGGAGGATGG - Intronic
1021041086 7:15863140-15863162 GTAAATTAACAGAGGCACAATGG + Intergenic
1022384989 7:29891501-29891523 CTGAGTTGAGAGAGAGAGAAAGG + Intronic
1022423740 7:30247864-30247886 CTAATTGGACAAAGGAAGAAAGG - Intergenic
1022464884 7:30646957-30646979 CTGAATGGCCAGAGGGAGTACGG + Intergenic
1022636814 7:32144006-32144028 CTGAATTGAGAGATGGAGATGGG + Intronic
1023018019 7:35985224-35985246 CTAAATGGACAGAAGGCGACAGG - Intergenic
1026870206 7:73846411-73846433 CCAAAGTGACAGAGGGAGCTTGG + Intergenic
1030190365 7:106804531-106804553 CTATTGTGACAGAGGGAGAAAGG + Intergenic
1030542932 7:110855633-110855655 ATAAATTGACAGATGGCTAAGGG - Intronic
1030626587 7:111851827-111851849 TAAAATTGAAAGAGGAAGAAAGG - Intronic
1030724748 7:112913682-112913704 GCAAAATGACAGAGGGAGAGAGG - Intronic
1030908203 7:115212668-115212690 ATAAATGCACAGTGGGAGAATGG + Intergenic
1031554845 7:123161560-123161582 CAGAATGGACAGAGGGAGATGGG + Intronic
1032547733 7:132757753-132757775 CTGCATTGACACAGGGAGAAAGG + Intergenic
1032847697 7:135765927-135765949 CATATTGGACAGAGGGAGAAAGG + Intergenic
1034525114 7:151654442-151654464 CTATATGGACAGTGGGAGGAAGG - Intronic
1036279041 8:7383529-7383551 ATAAATTGACAGAGGGAGGAAGG + Intronic
1036342477 8:7928345-7928367 ATAAATTGACGGAGGGAGGAAGG - Intronic
1037136472 8:15468511-15468533 CTAATTTGACAGAGTGAAGAGGG - Intronic
1037848448 8:22305738-22305760 GTACAGTGACTGAGGGAGAAAGG + Intronic
1038095438 8:24304429-24304451 CTAAATTTATACAGAGAGAATGG - Intronic
1039575453 8:38620176-38620198 CTGAATGGGCAGAGGGAAAAAGG - Intergenic
1039628761 8:39085126-39085148 CTTAATTGAAAGACAGAGAATGG - Intronic
1040781106 8:51110513-51110535 CTTAAATGACAGAGGCAAAAAGG + Intergenic
1041250781 8:55932959-55932981 CTAAAGTGGGGGAGGGAGAAGGG + Intronic
1041774201 8:61506275-61506297 TTAAATTCACAGAGAGAGAAAGG + Intronic
1041786099 8:61636366-61636388 CTATAGAGACAGAGGGAGAGAGG + Intronic
1041898596 8:62956127-62956149 GTAGATTGACAGAGGCAGACTGG - Intronic
1041988724 8:63958702-63958724 CTAAAATGACAGAGTGAGGATGG + Intergenic
1043068523 8:75608044-75608066 CTAAAGTGAGAGAGAGAGAGGGG + Intergenic
1043450086 8:80357555-80357577 ATAAACTGACAGAGGGACGAAGG - Intergenic
1043465241 8:80499581-80499603 CTAAATGAACAGAGAAAGAAAGG + Exonic
1043943413 8:86222825-86222847 CTAAAATAACAGAGGGCCAAAGG - Intronic
1044265724 8:90179051-90179073 CTACATTAAGAGAGGTAGAAAGG - Intergenic
1045065969 8:98444564-98444586 CTGAACTGGCAGAGGTAGAATGG + Intronic
1045885660 8:107094990-107095012 TTAAATTGACAGATGGCTAACGG + Intergenic
1047311968 8:123699563-123699585 CCACATTGTCAGAGGGAGACAGG - Intronic
1047433530 8:124814937-124814959 CAAAATAGACACAGGGAGATTGG + Intergenic
1047900564 8:129417227-129417249 CTAAATTGGTAAAGGTAGAATGG - Intergenic
1048470963 8:134703856-134703878 GAAGACTGACAGAGGGAGAATGG + Intronic
1049426470 8:142540134-142540156 CTAAATGACCAGAGGGAGCATGG - Intronic
1049941755 9:552702-552724 CTAAATTGTCACAGGGAAAAAGG - Intronic
1054893375 9:70278770-70278792 TTAAAGTGACAGAGTGAGAATGG + Intronic
1058520271 9:105809219-105809241 CAAAATAGACAGAAGGAGAGAGG + Intergenic
1059297452 9:113284334-113284356 CTAAAGTGACAGTAGGAGATAGG - Exonic
1186188187 X:7042097-7042119 ATAAATGAAAAGAGGGAGAAGGG - Intergenic
1189759211 X:44304281-44304303 GTAAATTGCCAGAGGTAAAAGGG + Intronic
1190332583 X:49245007-49245029 AGAAATGGACAGAGGGAGAGGGG - Intronic
1190715924 X:53103532-53103554 CTGAAGTGGCAGAGGGCGAAGGG - Intergenic
1191670577 X:63745018-63745040 CACAATTCACAGAGGGAGGAGGG + Intronic
1193712360 X:84894722-84894744 CCAAATTGACCGGGGGAGGAAGG - Intergenic
1194845728 X:98806358-98806380 CTAAATTTAAAGAATGAGAAAGG + Intergenic
1195598954 X:106724537-106724559 CTAAAGTAACAGAGGGAGGGTGG - Intronic
1196060461 X:111402892-111402914 CTATCTTGACAGGGGGACAAAGG + Intronic
1197043310 X:121966655-121966677 CTGAAGAGACAGAGGTAGAAAGG + Intergenic
1197283767 X:124569260-124569282 CAAAATTGAAAGAAGAAGAAAGG + Intronic
1197816417 X:130503342-130503364 CAAAAATGATAGAGAGAGAAAGG - Intergenic
1198230894 X:134688331-134688353 ATAATTTGACAAAGTGAGAACGG - Intronic
1198607465 X:138357205-138357227 CTATACTGAAAGAGGGAAAAGGG - Intergenic
1202089923 Y:21178780-21178802 CTTAAATCAGAGAGGGAGAAGGG + Intergenic
1202349627 Y:23973966-23973988 ATAAAGTGAGGGAGGGAGAAAGG - Intergenic
1202521148 Y:25696138-25696160 ATAAAGTGAGGGAGGGAGAAAGG + Intergenic