ID: 956760461

View in Genome Browser
Species Human (GRCh38)
Location 3:72438881-72438903
Sequence GTGTGTTATGCCAAACTGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 108}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956760461_956760464 -2 Left 956760461 3:72438881-72438903 CCAAGCAGTTTGGCATAACACAC 0: 1
1: 0
2: 0
3: 5
4: 108
Right 956760464 3:72438902-72438924 ACACAAACGCTGTGTATGGAGGG 0: 1
1: 0
2: 0
3: 12
4: 84
956760461_956760465 5 Left 956760461 3:72438881-72438903 CCAAGCAGTTTGGCATAACACAC 0: 1
1: 0
2: 0
3: 5
4: 108
Right 956760465 3:72438909-72438931 CGCTGTGTATGGAGGGCAGACGG 0: 1
1: 0
2: 1
3: 16
4: 204
956760461_956760466 17 Left 956760461 3:72438881-72438903 CCAAGCAGTTTGGCATAACACAC 0: 1
1: 0
2: 0
3: 5
4: 108
Right 956760466 3:72438921-72438943 AGGGCAGACGGAGCGATGATAGG 0: 1
1: 0
2: 0
3: 4
4: 88
956760461_956760463 -3 Left 956760461 3:72438881-72438903 CCAAGCAGTTTGGCATAACACAC 0: 1
1: 0
2: 0
3: 5
4: 108
Right 956760463 3:72438901-72438923 CACACAAACGCTGTGTATGGAGG 0: 1
1: 0
2: 2
3: 17
4: 173
956760461_956760462 -6 Left 956760461 3:72438881-72438903 CCAAGCAGTTTGGCATAACACAC 0: 1
1: 0
2: 0
3: 5
4: 108
Right 956760462 3:72438898-72438920 ACACACACAAACGCTGTGTATGG 0: 1
1: 0
2: 3
3: 32
4: 347

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956760461 Original CRISPR GTGTGTTATGCCAAACTGCT TGG (reversed) Intronic
902377397 1:16036318-16036340 CTCTGTGATGGCAAACTGCTCGG + Intergenic
902382574 1:16059576-16059598 CTCTGTGATGGCAAACTGCTCGG + Exonic
912782388 1:112563565-112563587 GTCTGTAATGAGAAACTGCTTGG + Intronic
913049169 1:115100887-115100909 GTGTGTTCTGCCAAACGTTTAGG + Intergenic
915069285 1:153252731-153252753 ATTTGCTATGGCAAACTGCTGGG - Intergenic
918367191 1:183820868-183820890 GTATGTAATCCCAAAGTGCTGGG - Intronic
920704597 1:208242427-208242449 GTGGGTTCTTCCAAACTGATGGG + Intronic
921749816 1:218779299-218779321 GTGTGTGATGCCAAAATCTTAGG + Intergenic
1065725952 10:28668293-28668315 GTGTGTTTTTCAAAACTACTGGG - Intergenic
1068971088 10:62959212-62959234 GTGTGTAAGCCCAAAATGCTGGG - Intergenic
1069215950 10:65821559-65821581 GTATGTTATGACAAACTTATAGG + Intergenic
1072625804 10:97110950-97110972 GTGATTTATCCCAAAGTGCTGGG - Intronic
1079312901 11:19381956-19381978 GTGTCCTATGCCAATCTGCTGGG + Intronic
1086152369 11:83626029-83626051 GTGCATTATGCCACAGTGCTTGG - Intronic
1086686517 11:89739808-89739830 GTGTGTTTATCCAAACTGATGGG - Intergenic
1086699981 11:89890273-89890295 GTGTGTTTATCCAAACTGATGGG + Intergenic
1086706189 11:89954243-89954265 GTGTGTTTATCCAAACTGATGGG - Intergenic
1089757743 11:120698797-120698819 CTGTGTTATGCCTCCCTGCTGGG - Intronic
1097646662 12:62243017-62243039 GTGTGTTTTACCAAATTGTTTGG + Intronic
1098114039 12:67155650-67155672 GTATGTTTAGCCAAACTGTTTGG - Intergenic
1099346242 12:81503430-81503452 GTGTGTCATGCTAAACCACTTGG - Intronic
1104304686 12:127599076-127599098 GTGTTTTATGAGAAAATGCTTGG - Intergenic
1108019340 13:46110755-46110777 GTGAGTAATCCCAAATTGCTGGG + Intergenic
1111393279 13:87627140-87627162 TTGTTTTATGCCAAAAAGCTTGG + Intergenic
1120648228 14:87098785-87098807 GTGTGTTATGACAAATTGTGAGG + Intergenic
1124617878 15:31255761-31255783 GTGTTTTATGCCACAAAGCTCGG + Intergenic
1126332930 15:47553403-47553425 GTGTTTTATGCAATCCTGCTGGG - Intronic
1128783568 15:70378749-70378771 GTGTGAGATGCCAGACTCCTGGG - Intergenic
1129492141 15:75937813-75937835 GTTTGTTTTGCCTAACTGGTAGG + Exonic
1132182284 15:99766521-99766543 TTGTGTTATGCTACCCTGCTAGG + Intergenic
1133013355 16:2927104-2927126 GTGTGCCATGCCAAATTGCACGG + Intronic
1137641747 16:50037913-50037935 GACTGTTAGGCCAAACTGCCTGG + Intergenic
1138153229 16:54678718-54678740 CTGAGTTATGCCAAAATCCTAGG + Intergenic
1143461869 17:7109030-7109052 GTGTGTAATGCTCAAATGCTGGG - Intronic
1151965487 17:77429111-77429133 GTGTGTGAGGCCAAGCTCCTGGG + Intronic
1153083227 18:1253066-1253088 GTGTGCTACCCCACACTGCTAGG + Intergenic
1153103929 18:1506087-1506109 GTGCCTTCTGCCAAACTGCATGG + Intergenic
1153562689 18:6387102-6387124 GTGTGTTTTGCCAAAAACCTGGG - Intronic
1158132200 18:54164569-54164591 ATGTGTTAAGCCAAACAGCAGGG + Exonic
1158313898 18:56189442-56189464 GTGTGTTCTGTCAGACTGATTGG - Intergenic
1159497131 18:69221287-69221309 TTGTGTTATGCCAAACTCCATGG - Intergenic
1160179443 18:76621017-76621039 GTCTGTGAGTCCAAACTGCTAGG - Intergenic
1163679695 19:18673706-18673728 GTGTGTATTGCAAAACTGGTTGG - Intergenic
1164325679 19:24189335-24189357 GTGTGTTATGCCATATTTTTGGG - Intergenic
1164470229 19:28523830-28523852 GTTTGTTATGACCAGCTGCTGGG - Intergenic
1165286761 19:34849161-34849183 GAGTTTTATGCCAAACAGGTTGG + Intergenic
925400959 2:3572307-3572329 GTGGATTATCCCAAAGTGCTGGG + Intergenic
927119748 2:19946813-19946835 TTGTGTATTGCCAAAGTGCTAGG - Intronic
929839772 2:45446185-45446207 CTGTGTGAAGCCAACCTGCTGGG - Intronic
932507947 2:72254759-72254781 GAGTTTTCTGCCAAAGTGCTAGG - Intronic
934581149 2:95440366-95440388 GTGTGTTTATCCAAACTGATGGG - Intergenic
934598301 2:95636348-95636370 GTGTGTTTATCCAAACTGATGGG + Intergenic
937164325 2:119796892-119796914 GTGTGTTTTGCCATTCTGATAGG + Intronic
938026855 2:127956819-127956841 GTGTCTTCTGCAAAACTGATTGG + Intronic
939674874 2:145060164-145060186 GTGAGCCAGGCCAAACTGCTCGG + Intergenic
940389824 2:153119274-153119296 GTGTCTAAAGCCAAACTGCATGG - Intergenic
940696793 2:156989809-156989831 GTGTGTTTTCCAAAACTACTGGG - Intergenic
947730897 2:232431102-232431124 GTCTGTAATCCCAAAGTGCTGGG + Intergenic
1174678820 20:52384595-52384617 GTGTGTGATGTCAAAATGCTGGG + Intergenic
1175341435 20:58233163-58233185 GTCTGTTATGCAAAACATCTAGG + Intergenic
1178320097 21:31598633-31598655 GTGTGTTATGCCAAGCCCTTCGG + Intergenic
1181263507 22:21615863-21615885 CTGTCTAATGCCAAACTTCTTGG + Intronic
1182598968 22:31444814-31444836 GTATGTTAGGCCTAAATGCTTGG - Intronic
954001478 3:47560808-47560830 CTGTGTCATCCCAAAGTGCTGGG + Intergenic
956760461 3:72438881-72438903 GTGTGTTATGCCAAACTGCTTGG - Intronic
960356671 3:116662334-116662356 GTGTGATGTGTCTAACTGCTCGG + Intronic
962075543 3:132077865-132077887 CTGTGTTATGCCTACCTGTTAGG + Intronic
963609046 3:147442146-147442168 GTGTGGTCTCCCAAAGTGCTGGG + Intronic
964753123 3:160070331-160070353 GTGTGCTCTGGAAAACTGCTGGG - Intergenic
976382852 4:84420089-84420111 GAGTGGAAAGCCAAACTGCTGGG + Intergenic
977995477 4:103494427-103494449 GTGGTTTAGGCCAAAATGCTAGG + Intergenic
980020064 4:127698180-127698202 GTGTGTACTCCCAAAGTGCTGGG - Intronic
987244847 5:16038189-16038211 TTGAGTGATGTCAAACTGCTGGG + Intergenic
988616245 5:32777886-32777908 GTGTATTGTGCAAAACTTCTGGG - Intronic
989035757 5:37169963-37169985 GTGTGGCCTGCCAAAGTGCTGGG + Intronic
993556351 5:89344321-89344343 GTGTGTTGTGATAAACTGTTTGG + Intergenic
995685830 5:114771438-114771460 GGGTATTATTCCAAACTGCCAGG - Intergenic
995845096 5:116484942-116484964 GTGTGTCATGCCAGAGAGCTAGG + Intronic
1001656289 5:173353165-173353187 TTGTGTGATGCCAAACATCTGGG + Intergenic
1005497447 6:26400556-26400578 AAGTTTTATGACAAACTGCTGGG + Intergenic
1006791158 6:36702155-36702177 GTGGCTGATGCCAAGCTGCTGGG + Intronic
1007771146 6:44193317-44193339 GGGTGTAATCCCAAAGTGCTGGG + Intergenic
1012325500 6:97911102-97911124 GTGGGTTAAGCCAAAATTCTAGG - Intergenic
1016945971 6:149533904-149533926 GCGTGTTCTCCCAAAGTGCTGGG - Intronic
1017731342 6:157319594-157319616 GTGTGTCATGCAAAACAACTGGG - Intronic
1018446248 6:163861785-163861807 GTGTGGGATGCCCATCTGCTTGG - Intergenic
1019811403 7:3167829-3167851 GTGTGCTTTGCCACACTGCCTGG + Intronic
1022689912 7:32638687-32638709 GTCTGTTATGCCAAACTCTTTGG - Intergenic
1023302806 7:38792009-38792031 GTGAGTGATGCCAGACTGCCTGG + Intronic
1023759768 7:43454037-43454059 GTGTAGTAAGCCAAACAGCTGGG - Intronic
1027506131 7:79019128-79019150 TTGTTTTATGCCCAACTGTTTGG - Intronic
1033735827 7:144220705-144220727 GTTTGTACTGCCAAACTACTGGG - Intergenic
1033747224 7:144330248-144330270 GTTTGTACTGCCAAACTACTGGG + Intergenic
1034078850 7:148258202-148258224 GTGTGTTATGCCACGCTCCTGGG + Intronic
1040512666 8:48108711-48108733 GGGTGTTCTGCCTGACTGCTGGG - Intergenic
1048490323 8:134885950-134885972 GTGTACTATCCCAGACTGCTTGG - Intergenic
1053091583 9:35282889-35282911 GTGTGTTAAGCTAAACTTATAGG - Intronic
1058651530 9:107179509-107179531 ATGTGTGAAGCCAAACTGTTAGG + Intergenic
1058987247 9:110219837-110219859 GAGTGTGGGGCCAAACTGCTGGG - Intergenic
1059977788 9:119736623-119736645 GTGTGTTATGTGTAACTGATGGG - Intergenic
1060645567 9:125276439-125276461 CTGTGTAATCCCAAAGTGCTGGG - Intronic
1061045890 9:128164699-128164721 CTGTGGCATTCCAAACTGCTGGG - Intergenic
1185701010 X:2230287-2230309 GTGGGTTGTGCTAAACTTCTAGG + Intronic
1186103095 X:6177414-6177436 GGGTGTAATCCCAAAGTGCTGGG + Intronic
1191578342 X:62732232-62732254 ATGTGTTTTTCCAACCTGCTGGG + Intergenic
1194356829 X:92895975-92895997 GTGTGTGATGGCAAAGTGGTGGG + Intergenic
1194752008 X:97695334-97695356 TTGTGTTATTACAAACTGATAGG - Intergenic
1194970175 X:100334156-100334178 GTGTGTTTTCCCAATCTACTTGG - Intronic
1196133823 X:112185668-112185690 CTCTCTTATGCTAAACTGCTTGG + Intergenic
1196354108 X:114769295-114769317 TTTTGTTATGCTTAACTGCTTGG - Intronic
1199513893 X:148654344-148654366 TTGTGGGATGCCAAACTGCCAGG + Intronic
1200403812 Y:2788175-2788197 GTATTTTATGCCCAACTTCTAGG + Intergenic
1200665161 Y:6012969-6012991 GTGTGTGATGGCAAAGTGGTGGG + Intergenic
1200862991 Y:8012900-8012922 GTGTGTTGTGACATATTGCTGGG - Intergenic