ID: 956760465

View in Genome Browser
Species Human (GRCh38)
Location 3:72438909-72438931
Sequence CGCTGTGTATGGAGGGCAGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 204}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956760461_956760465 5 Left 956760461 3:72438881-72438903 CCAAGCAGTTTGGCATAACACAC 0: 1
1: 0
2: 0
3: 5
4: 108
Right 956760465 3:72438909-72438931 CGCTGTGTATGGAGGGCAGACGG 0: 1
1: 0
2: 1
3: 16
4: 204
956760459_956760465 21 Left 956760459 3:72438865-72438887 CCACGGTTGGAAAACACCAAGCA 0: 1
1: 0
2: 0
3: 5
4: 82
Right 956760465 3:72438909-72438931 CGCTGTGTATGGAGGGCAGACGG 0: 1
1: 0
2: 1
3: 16
4: 204

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956760465 Original CRISPR CGCTGTGTATGGAGGGCAGA CGG Intronic
900760404 1:4466719-4466741 CACTGTGTCTGCAGGGCAGTAGG - Intergenic
901243448 1:7709197-7709219 AGCTGTTTATGGGGTGCAGAGGG + Intronic
901843018 1:11965518-11965540 AGCTGTCTAGGGAGAGCAGATGG - Exonic
901886717 1:12228831-12228853 CACTCTGTCTGGAGTGCAGAGGG + Intergenic
903014500 1:20353307-20353329 CCCTCTGTATGTAGGACAGATGG + Intronic
903019792 1:20386063-20386085 CTGTGTTTCTGGAGGGCAGAAGG - Intergenic
903172996 1:21565149-21565171 GGCAGTGCATGGAGGGCTGAAGG - Intronic
903353338 1:22731231-22731253 CGGGGGGAATGGAGGGCAGAGGG + Intronic
904234047 1:29102332-29102354 TACTGTTTATGGAGGGGAGAAGG + Intronic
904775381 1:32902794-32902816 CGCTGTGTGTGTTGGGCAGTTGG + Intergenic
906886151 1:49650996-49651018 CTCTGTGTACGGAGGGCAGATGG - Intronic
907734479 1:57098475-57098497 TTGTGTGTCTGGAGGGCAGAAGG + Intronic
908098200 1:60762814-60762836 GGCTGTGTGTGGTGGGAAGAGGG + Intergenic
910429021 1:87143031-87143053 CGCTGTGTGAGGAGGGCGGCAGG - Intronic
911043164 1:93607881-93607903 TGCTGTGTCTGGTGGGCGGATGG - Intronic
913206406 1:116543225-116543247 GGCTGAGTAGGGAGGGCAGCAGG + Intronic
919944874 1:202311831-202311853 CACAGTGTATGGAGGGCAAATGG + Intronic
920694852 1:208174432-208174454 GGCTGTGGAGGGAGGGAAGAAGG + Intronic
921182987 1:212645984-212646006 GGCTGGGTTTGGTGGGCAGATGG + Intergenic
921389656 1:214605758-214605780 CGCTGTGGGTGGAGGGCACCAGG - Intronic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
1062904494 10:1170685-1170707 AGCTCTGTGTGGAGGGGAGAGGG - Intergenic
1062934282 10:1374612-1374634 CGCTGCATACGGCGGGCAGAGGG - Intronic
1064103739 10:12484338-12484360 CTCTGTGTTTGGAGGGAGGAGGG + Intronic
1065117674 10:22498236-22498258 CTCTATGTATGCAGGTCAGAGGG + Intergenic
1067544601 10:47183939-47183961 CTCTGTGGTTGGAGGGCAGAGGG + Intergenic
1068100545 10:52547207-52547229 CCATGGGTATGGAGGGCTGACGG - Intergenic
1068931624 10:62596220-62596242 CCATCTGCATGGAGGGCAGAAGG - Intronic
1069745739 10:70713734-70713756 CGCTGTGTATGGGGGTGAGTTGG + Intronic
1069780356 10:70951552-70951574 CCTTATTTATGGAGGGCAGAGGG - Intergenic
1071523719 10:86346404-86346426 GCCTGTGTTTGGAGGGCAGCTGG + Intronic
1073200101 10:101728304-101728326 CTGTGTTTATGGAGGACAGAGGG - Intergenic
1076504142 10:130960786-130960808 GGCTGGGTATTGGGGGCAGATGG + Intergenic
1078067999 11:8090364-8090386 AGCTGAGTAGGGAGGGCAGAGGG + Intronic
1079614811 11:22479206-22479228 CACTCAGTATGGAGGGTAGAAGG + Intergenic
1080232507 11:30033806-30033828 ACCTGAGTATGGAGGGTAGAAGG + Intergenic
1080668965 11:34358548-34358570 GGCTGTGTTTGGAGGGAGGAGGG + Intergenic
1080776974 11:35395101-35395123 CCCTGAGTAGGGAGGGCAGTGGG + Intronic
1084075339 11:66770797-66770819 CGATGGGTAAGGAGGCCAGAAGG - Intronic
1084486441 11:69450936-69450958 GGCTGTGTTTGGAAGGCTGATGG - Intergenic
1085465814 11:76722521-76722543 AGGTGTGTATGCAGGGCACAGGG - Intergenic
1086436998 11:86791361-86791383 ATCTGTGTGCGGAGGGCAGAAGG + Intronic
1091254455 11:134171811-134171833 TGCTGTGTTTGGAGGACAGCCGG - Intronic
1091415142 12:276368-276390 TGCTGTGTATGGAGGGATAAAGG + Intergenic
1094210442 12:27884820-27884842 CTCTGGGGATGGAGGGCACAAGG + Intergenic
1094297961 12:28928896-28928918 GCCTGTGTATGGAGTGGAGAGGG + Intergenic
1096801867 12:54115718-54115740 GGCTGTGTCTGAAGGGCAGCAGG + Intergenic
1097931247 12:65189369-65189391 CTCTGTGTCCGGAGGGCAGTTGG + Intronic
1098171521 12:67751803-67751825 CGCAGTGGCTGGAGGGCCGAAGG - Intergenic
1100220972 12:92504355-92504377 CCCTGTGTATGGAGCTCAAAGGG - Intergenic
1103251774 12:119506139-119506161 CTCTGGGTAAGAAGGGCAGAAGG - Intronic
1103446999 12:121001123-121001145 CGCTGTGGTTGGATGGCAGCAGG - Exonic
1103595900 12:122024029-122024051 TGCTCTGCAGGGAGGGCAGATGG + Intronic
1104464702 12:128980740-128980762 AGCTTTGTGTGGAAGGCAGACGG + Intronic
1104714149 12:131005536-131005558 CTCTGCGTGTGGAGGGCAGACGG + Intronic
1105767321 13:23574734-23574756 CTCTGTGATGGGAGGGCAGAGGG + Intronic
1106592441 13:31109488-31109510 TGCTGTGCATGGAAGGGAGAGGG - Intergenic
1108546857 13:51503550-51503572 CGCTGAGTATGGTGGGGAGGGGG - Intergenic
1110763247 13:79253429-79253451 AGCTGTGTGTGGAGGAAAGAAGG - Intergenic
1110809429 13:79795119-79795141 AGCTCTGTATGGAATGCAGATGG + Intergenic
1114492561 14:23112642-23112664 GGCTGGGGATGGAGGGGAGAAGG + Intergenic
1114755255 14:25252609-25252631 TGGTGTGTATGTAGGGCAGCTGG + Intergenic
1118306790 14:64661757-64661779 CGCTGTGTGTGGAGGAGAAAGGG + Intergenic
1119414258 14:74459123-74459145 CTCTGTCTCTGGAGGGGAGAGGG + Intergenic
1120183364 14:81367793-81367815 CTCTGGGCCTGGAGGGCAGATGG + Intronic
1120193578 14:81460911-81460933 AGTTGTGTATGGAGGGCCTATGG - Intergenic
1121555255 14:94831662-94831684 CAGTGGGAATGGAGGGCAGAAGG + Intergenic
1121732125 14:96194307-96194329 TGCTGCATAGGGAGGGCAGAAGG + Intergenic
1123061589 14:105597071-105597093 GGCTGTGGATGGATGGCAGGAGG + Intergenic
1123086153 14:105718309-105718331 GGCTGTGGATGGATGGCAGGAGG + Intergenic
1123086182 14:105718391-105718413 GGCTGTGGATGGATGGCAGGAGG + Intergenic
1123086211 14:105718473-105718495 GGCTGTGGATGGATGGCAGGAGG + Intergenic
1123086240 14:105718555-105718577 GGCTGTGGATGGATGGCAGGAGG + Intergenic
1123086269 14:105718637-105718659 GGCTGTGGATGGATGGCAGGAGG + Intergenic
1123086298 14:105718719-105718741 GGCTGTGGATGGATGGCAGGAGG + Intergenic
1123086327 14:105718801-105718823 GGCTGTGGATGGATGGCAGGAGG + Intergenic
1124598368 15:31110514-31110536 CTCTTTGTCTGGAAGGCAGAGGG + Intronic
1125201915 15:37107484-37107506 CGCCGGGTAGGGAGGTCAGAGGG + Intergenic
1127110907 15:55669396-55669418 TGATGTGTCTGGAGGGCAGTAGG - Intronic
1128731792 15:70026310-70026332 TGCTGTGTAGGGAAAGCAGAAGG + Intergenic
1129269520 15:74412011-74412033 GTCTGTGTATGGTGGACAGAGGG + Exonic
1131163525 15:90125811-90125833 CGCTGTTCATGTGGGGCAGATGG + Intergenic
1131786229 15:95914003-95914025 CACTGTGTAGGGAGGGGGGATGG + Intergenic
1132514534 16:360044-360066 CGCTGGGGATAGTGGGCAGAAGG - Intergenic
1132612324 16:823483-823505 CCCTGTGTATCACGGGCAGAAGG + Intergenic
1133198126 16:4184842-4184864 CGCTGTGTGTGGCGGGGATAAGG - Intergenic
1134680871 16:16124599-16124621 CGCAGGGTAGGGAGGGCCGAAGG - Intronic
1137638790 16:50010361-50010383 CACTGTGTTTGGAGGGAGGATGG + Intergenic
1146000359 17:29126921-29126943 CCCTGTGCTTGGATGGCAGATGG - Intronic
1146273568 17:31500029-31500051 GGCTCTGTTTGCAGGGCAGAGGG + Intronic
1148111497 17:45147127-45147149 CCCTGTTTATGGAGGGCTGGGGG + Intergenic
1151660581 17:75516176-75516198 GGCTGGGCAAGGAGGGCAGAAGG - Intronic
1152080392 17:78183820-78183842 CTCTGTTTAGGGAGGGAAGAGGG - Intronic
1152363265 17:79842076-79842098 CTTTGTGGATGGTGGGCAGATGG + Intergenic
1152947175 17:83204136-83204158 GGCTGTGTATGGGGGGAAGCTGG + Intergenic
1156886478 18:42141284-42141306 TGCTGTGCATGGAGTGGAGAGGG - Intergenic
1157521722 18:48349933-48349955 CCCTGTTTATGAAGGGCAGGTGG - Intronic
1157890487 18:51411333-51411355 AGCTGTGTAGGGAGGGCTGTGGG + Intergenic
1158909551 18:62046560-62046582 CGCTGTGTATGTGGGGGTGAGGG - Intronic
1160018745 18:75164332-75164354 TGCTGTTTCTGGAGCGCAGAGGG + Intergenic
1160178852 18:76617485-76617507 CACTGTGTCCTGAGGGCAGAGGG + Intergenic
1160179039 18:76618686-76618708 GGCTGTGTCTTGAGGGAAGAAGG + Intergenic
1160627716 18:80223988-80224010 GGCTGGGTAAGGAGGACAGAGGG + Intronic
1161234475 19:3191001-3191023 CGCGGTGTGTGGCGGGCAGCAGG + Intronic
1161234487 19:3191063-3191085 CGCGGTGTGTGGCGGGCAGCAGG + Intronic
1161267447 19:3370885-3370907 CGCTGTGTGCTCAGGGCAGATGG - Intronic
1161768153 19:6217933-6217955 AGGTGTGTATGGAGAGCAGCTGG - Exonic
1165412059 19:35668140-35668162 CACTGTCAAGGGAGGGCAGATGG + Intronic
1165756488 19:38296208-38296230 TGCTGGGTCTGGAGGCCAGAGGG - Intronic
1165778960 19:38421054-38421076 AGCTATGGGTGGAGGGCAGAGGG - Intronic
1166214471 19:41326174-41326196 CGCTGGGTATGGAGGCCAACAGG + Intronic
1168124603 19:54276500-54276522 AGCTGTGTGTGCAGGGCAGGGGG - Intronic
1168177384 19:54635038-54635060 AGCTGTGTGTGCAGGGCAGGGGG + Intronic
925104411 2:1278245-1278267 TATTGTTTATGGAGGGCAGAAGG + Intronic
925104428 2:1278389-1278411 TGCTGTTTATGGAGGGCACCAGG + Intronic
925505100 2:4553858-4553880 GGCTTTGTGTAGAGGGCAGAGGG - Intergenic
927135954 2:20096689-20096711 CTATGAGAATGGAGGGCAGAGGG - Intergenic
927515956 2:23671808-23671830 GGCTGGGGATGGAGGGCAGCGGG + Intronic
927964223 2:27259122-27259144 CTCTGTGTATGGAAGGAAAAGGG - Intronic
928111844 2:28516895-28516917 GCGTGTGTATGGAGGGGAGAGGG + Intronic
929564993 2:42978640-42978662 CCCAGTGGATGGAGGGCACATGG + Intergenic
929763612 2:44826212-44826234 AGATTTGTCTGGAGGGCAGAAGG - Intergenic
931157824 2:59655354-59655376 CGGTGAGTATTGAGAGCAGAGGG - Intergenic
932739754 2:74282612-74282634 CACTGGGTCTGGAGTGCAGAGGG + Intronic
933155506 2:78968885-78968907 TGCTGTGGATGGAGGGGTGAGGG - Intergenic
933729254 2:85444910-85444932 GTCTGTGAATGGAGGGGAGAGGG + Intergenic
935363519 2:102267405-102267427 CCCTGTGAATGGAGGTCAGCAGG - Intergenic
937090916 2:119205612-119205634 GGCTGTGTGTGGAAGGCAAAGGG + Intergenic
937335868 2:121062111-121062133 CGCTCTTTCTGGAGGTCAGAGGG + Intergenic
937996467 2:127698271-127698293 CACTGTGAATGGAGCCCAGAAGG + Intergenic
938702092 2:133888552-133888574 TGAAGTGCATGGAGGGCAGAGGG + Intergenic
942438807 2:176009918-176009940 CGCTGTATATATAAGGCAGATGG + Intergenic
944637607 2:201689924-201689946 CCCTGTTTATGAAGGGCAAATGG + Intronic
945090933 2:206174905-206174927 AGCTGTGTTGGGAGGGGAGAGGG + Intergenic
946814578 2:223563701-223563723 GGCTGTCTCTGGAAGGCAGATGG - Intergenic
948229828 2:236341744-236341766 TGCTGTGTGTGGTGGGGAGAAGG + Intronic
948627224 2:239276590-239276612 GCCTGTGTCTGGAGAGCAGATGG - Intronic
948770449 2:240248953-240248975 AGGTGAGTATGGGGGGCAGAGGG + Intergenic
948850311 2:240702408-240702430 CACTTTGTGTGGAGGTCAGAGGG - Intergenic
948917011 2:241039528-241039550 CGGTGAGGAGGGAGGGCAGAGGG + Intronic
1171794844 20:29558748-29558770 GGCTGTGTCTGAAGGGCAGCAGG - Intergenic
1171853612 20:30325517-30325539 GGCTGTGTCTGAAGGGCAGCAGG + Intergenic
1172601989 20:36190417-36190439 CCATGTGTATGGAGGGGAGCAGG + Intronic
1173300644 20:41799364-41799386 AGCTGAGTATGGAGGGAAGCTGG + Intergenic
1174076775 20:47942843-47942865 CGCTGTGTGTCGAGGGCATGTGG + Intergenic
1174285679 20:49471313-49471335 TGCTGTGTGTGGAGACCAGACGG + Intronic
1177773145 21:25539450-25539472 CACTGCTTGTGGAGGGCAGAGGG - Intergenic
1178116864 21:29426843-29426865 CTCTTTGTCTGGAGGGGAGAAGG - Intronic
1178938992 21:36889320-36889342 CGCAGTGTGTGGTGAGCAGATGG - Intronic
1179654805 21:42838235-42838257 GGCTGTGGAAGGAGGCCAGAAGG - Intergenic
1183981006 22:41540204-41540226 CGCTGCCTGTGGAGAGCAGACGG - Intronic
949584933 3:5428162-5428184 CTCTGTGTCTGCGGGGCAGAAGG - Intergenic
950250436 3:11460881-11460903 CCATGTGTATGGAGCCCAGAGGG + Intronic
953930952 3:47005409-47005431 TGCTGTGGCTGGAGGGAAGAAGG - Intronic
955408651 3:58641975-58641997 CGCTGTGGGGTGAGGGCAGATGG + Intronic
956760465 3:72438909-72438931 CGCTGTGTATGGAGGGCAGACGG + Intronic
957121814 3:76103455-76103477 AGCTGTGTATTGTGAGCAGAGGG - Intronic
962358477 3:134715180-134715202 GGCTCTGTATGGAGGAGAGATGG - Intronic
963908179 3:150791503-150791525 CTCTGTGTGTGGAGGGCACATGG - Intergenic
966881611 3:184354054-184354076 GGCTGTGGGTGAAGGGCAGAGGG - Intronic
968603981 4:1522872-1522894 TGCTAGGGATGGAGGGCAGATGG - Intergenic
969276770 4:6141049-6141071 CGCTGTGAATGCTGGGCAGGGGG - Intronic
969451632 4:7277124-7277146 GGCTGTGTATGGAGGGTGGGTGG + Intronic
969699936 4:8762416-8762438 GTCTGTGGCTGGAGGGCAGAGGG - Intergenic
973090807 4:46133862-46133884 TGCTTTGTATAGAAGGCAGATGG + Intergenic
976226766 4:82800337-82800359 TGCTGGGTATGGGGAGCAGAGGG - Intergenic
977456178 4:97262878-97262900 CTCTGTGTATGAAGGGCCCATGG - Intronic
985319122 4:188689161-188689183 TGATGTGTATGGGGGGCATATGG + Intergenic
985525513 5:399487-399509 CTCTGTGACTGGAGGGCAAATGG - Intronic
985589293 5:756441-756463 GGCTGTGTGTGCAGGGCCGATGG - Intronic
985604010 5:849105-849127 GGCTGTGTGTGCAGGGCCGACGG - Intronic
985604022 5:849161-849183 GGCTGTGTATGCAGGGCCAATGG - Intronic
986774153 5:10998325-10998347 CACTTTGAATGGAGGGGAGAAGG + Intronic
987330066 5:16848672-16848694 CGCTACGGATGGACGGCAGAAGG + Intronic
988731950 5:33981187-33981209 CTCTGTGTAAGGAAGGCAGAGGG - Intronic
992786811 5:80177796-80177818 CACAGTGTCTGGTGGGCAGATGG + Intronic
996347788 5:122506073-122506095 CCCTGTTTATGGAGGGAAGATGG - Intergenic
996595132 5:125192124-125192146 CGCTGTATATGGAGCACAGATGG + Intergenic
1002680049 5:180954639-180954661 AGCTGAGTCTGGAGGCCAGAGGG + Intergenic
1004571615 6:16851265-16851287 CACTGTGTATGCATGGAAGAGGG + Intergenic
1005140485 6:22626234-22626256 CGCTGCCTATGGACTGCAGACGG + Intergenic
1006116219 6:31777409-31777431 CCCTGGTTCTGGAGGGCAGAGGG - Intergenic
1006244098 6:32715100-32715122 CACTGTGTATTGAGTGCTGATGG + Intergenic
1007556204 6:42768661-42768683 CACTGGGCATGGAGGGGAGAAGG - Intronic
1008876381 6:56334201-56334223 CCATGTTTCTGGAGGGCAGATGG - Intronic
1009741401 6:67751436-67751458 TGTTGTGTATGGTGGGCAGAGGG + Intergenic
1013015193 6:106154684-106154706 TGCTGTGCATGGAGGGGAAAGGG + Intergenic
1015721747 6:136249937-136249959 CGCTGTGTTTGGAGAGCACCAGG - Intronic
1021687971 7:23206050-23206072 CCCCGTGTCTGCAGGGCAGAGGG - Intergenic
1022259446 7:28690294-28690316 CTCTGTGTCTGGTGGGCAGAGGG - Intronic
1022899939 7:34797412-34797434 CTCTGTGTATGGGGGACAGGGGG + Intronic
1023385704 7:39655400-39655422 ATCAGTGTATGGAGGGGAGATGG + Intronic
1025262934 7:57432905-57432927 TTTTGTTTATGGAGGGCAGAAGG - Intergenic
1027520379 7:79199251-79199273 GGCTGCATTTGGAGGGCAGAAGG + Intronic
1029848730 7:103440971-103440993 CACTGTGTATGGAAGGCTGCAGG + Intronic
1032153688 7:129451379-129451401 GGCTGTGTGTGGAGGACAGAGGG + Intronic
1032505736 7:132433345-132433367 TGCTGGGTATGTAGGGTAGAAGG - Intronic
1034796859 7:154021592-154021614 CCCTGTGTATGTGGGGCTGAAGG + Intronic
1037896253 8:22658285-22658307 CTGTGTGTACGGAGGGCAAAGGG + Intronic
1038003855 8:23413467-23413489 CACTGTGTATGAGGGGCATATGG - Intronic
1038412084 8:27366804-27366826 GGCTGTGTGTGGAGAGCAGAGGG + Intronic
1040046286 8:42967258-42967280 AGGTGTGTGTGGAGGGCAGCCGG - Intronic
1040489512 8:47906590-47906612 CACTGTGTCTGGAGTGCAGTGGG - Intronic
1040727345 8:50398285-50398307 CGCCCTGTATGATGGGCAGATGG - Intronic
1042730230 8:71925455-71925477 TGCTGAGTGTGGAGGGCAGATGG - Intronic
1049069164 8:140343890-140343912 AGCTGAGTGTGGAGGGCAGAGGG + Intronic
1049463559 8:142740974-142740996 CGTGGGGTATGGAAGGCAGAGGG + Exonic
1054681091 9:67919642-67919664 AGCGGTGTGTGGAAGGCAGAAGG + Intergenic
1061152044 9:128834315-128834337 CCCTGGGTATAGAGGGCAGAGGG + Intronic
1061226076 9:129281695-129281717 CGCTGGGAGTGGAGGGCTGAGGG + Intergenic
1061892848 9:133631854-133631876 CCCTGTGTATGGAGGAGAGATGG + Intergenic
1062623512 9:137433136-137433158 CCCTGTGGGTGGAGGGCAGCCGG - Intronic
1185473704 X:400480-400502 CGCTATTTTTGGAGGGCAGCTGG + Intergenic
1186619620 X:11224835-11224857 GGCTGTGTATGTTGGGAAGATGG + Intronic
1186654917 X:11601992-11602014 CTGTGTGTATGGAGGTGAGAGGG + Intronic
1187069673 X:15875676-15875698 AGCTGTGGAAGGAGGACAGAGGG + Intergenic
1197128864 X:122980402-122980424 GGCTGTGTATGGAGGAAAGGAGG - Intergenic
1198734990 X:139775696-139775718 CCCTAGGTAAGGAGGGCAGAGGG - Intronic
1198852084 X:140975435-140975457 CACTGTGTTGGGAGGGCAGGTGG + Intergenic
1198882310 X:141294879-141294901 CTCTGTGTATGGGGGTCAGCTGG - Intergenic
1198968233 X:142250425-142250447 GCCTGTGTGTGGAGTGCAGAGGG + Intergenic
1201383535 Y:13413330-13413352 CGGTGTGGATAGAGGGCAGGAGG - Intronic