ID: 956766975

View in Genome Browser
Species Human (GRCh38)
Location 3:72492235-72492257
Sequence AGTCCATGCACAGGCCATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956766975_956766993 21 Left 956766975 3:72492235-72492257 CCTCCATGGCCTGTGCATGGACT No data
Right 956766993 3:72492279-72492301 AGGGGCCTGGGCTGGGTCCAGGG No data
956766975_956766982 1 Left 956766975 3:72492235-72492257 CCTCCATGGCCTGTGCATGGACT No data
Right 956766982 3:72492259-72492281 TGGGGGACACCAAATTTCCCAGG No data
956766975_956766985 8 Left 956766975 3:72492235-72492257 CCTCCATGGCCTGTGCATGGACT No data
Right 956766985 3:72492266-72492288 CACCAAATTTCCCAGGGGCCTGG No data
956766975_956766988 13 Left 956766975 3:72492235-72492257 CCTCCATGGCCTGTGCATGGACT No data
Right 956766988 3:72492271-72492293 AATTTCCCAGGGGCCTGGGCTGG No data
956766975_956766989 14 Left 956766975 3:72492235-72492257 CCTCCATGGCCTGTGCATGGACT No data
Right 956766989 3:72492272-72492294 ATTTCCCAGGGGCCTGGGCTGGG No data
956766975_956766984 3 Left 956766975 3:72492235-72492257 CCTCCATGGCCTGTGCATGGACT No data
Right 956766984 3:72492261-72492283 GGGGACACCAAATTTCCCAGGGG No data
956766975_956766992 20 Left 956766975 3:72492235-72492257 CCTCCATGGCCTGTGCATGGACT No data
Right 956766992 3:72492278-72492300 CAGGGGCCTGGGCTGGGTCCAGG No data
956766975_956766983 2 Left 956766975 3:72492235-72492257 CCTCCATGGCCTGTGCATGGACT No data
Right 956766983 3:72492260-72492282 GGGGGACACCAAATTTCCCAGGG No data
956766975_956766986 9 Left 956766975 3:72492235-72492257 CCTCCATGGCCTGTGCATGGACT No data
Right 956766986 3:72492267-72492289 ACCAAATTTCCCAGGGGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956766975 Original CRISPR AGTCCATGCACAGGCCATGG AGG (reversed) Intergenic
No off target data available for this crispr