ID: 956766982

View in Genome Browser
Species Human (GRCh38)
Location 3:72492259-72492281
Sequence TGGGGGACACCAAATTTCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956766975_956766982 1 Left 956766975 3:72492235-72492257 CCTCCATGGCCTGTGCATGGACT No data
Right 956766982 3:72492259-72492281 TGGGGGACACCAAATTTCCCAGG No data
956766981_956766982 -8 Left 956766981 3:72492244-72492266 CCTGTGCATGGACTGTGGGGGAC No data
Right 956766982 3:72492259-72492281 TGGGGGACACCAAATTTCCCAGG No data
956766976_956766982 -2 Left 956766976 3:72492238-72492260 CCATGGCCTGTGCATGGACTGTG No data
Right 956766982 3:72492259-72492281 TGGGGGACACCAAATTTCCCAGG No data
956766974_956766982 2 Left 956766974 3:72492234-72492256 CCCTCCATGGCCTGTGCATGGAC No data
Right 956766982 3:72492259-72492281 TGGGGGACACCAAATTTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956766982 Original CRISPR TGGGGGACACCAAATTTCCC AGG Intergenic
No off target data available for this crispr