ID: 956766984

View in Genome Browser
Species Human (GRCh38)
Location 3:72492261-72492283
Sequence GGGGACACCAAATTTCCCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956766974_956766984 4 Left 956766974 3:72492234-72492256 CCCTCCATGGCCTGTGCATGGAC No data
Right 956766984 3:72492261-72492283 GGGGACACCAAATTTCCCAGGGG No data
956766975_956766984 3 Left 956766975 3:72492235-72492257 CCTCCATGGCCTGTGCATGGACT No data
Right 956766984 3:72492261-72492283 GGGGACACCAAATTTCCCAGGGG No data
956766981_956766984 -6 Left 956766981 3:72492244-72492266 CCTGTGCATGGACTGTGGGGGAC No data
Right 956766984 3:72492261-72492283 GGGGACACCAAATTTCCCAGGGG No data
956766976_956766984 0 Left 956766976 3:72492238-72492260 CCATGGCCTGTGCATGGACTGTG No data
Right 956766984 3:72492261-72492283 GGGGACACCAAATTTCCCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956766984 Original CRISPR GGGGACACCAAATTTCCCAG GGG Intergenic
No off target data available for this crispr