ID: 956766988

View in Genome Browser
Species Human (GRCh38)
Location 3:72492271-72492293
Sequence AATTTCCCAGGGGCCTGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956766981_956766988 4 Left 956766981 3:72492244-72492266 CCTGTGCATGGACTGTGGGGGAC No data
Right 956766988 3:72492271-72492293 AATTTCCCAGGGGCCTGGGCTGG No data
956766976_956766988 10 Left 956766976 3:72492238-72492260 CCATGGCCTGTGCATGGACTGTG No data
Right 956766988 3:72492271-72492293 AATTTCCCAGGGGCCTGGGCTGG No data
956766974_956766988 14 Left 956766974 3:72492234-72492256 CCCTCCATGGCCTGTGCATGGAC No data
Right 956766988 3:72492271-72492293 AATTTCCCAGGGGCCTGGGCTGG No data
956766975_956766988 13 Left 956766975 3:72492235-72492257 CCTCCATGGCCTGTGCATGGACT No data
Right 956766988 3:72492271-72492293 AATTTCCCAGGGGCCTGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956766988 Original CRISPR AATTTCCCAGGGGCCTGGGC TGG Intergenic
No off target data available for this crispr