ID: 956768329

View in Genome Browser
Species Human (GRCh38)
Location 3:72503356-72503378
Sequence CTTAGTAGGACTATTTCTGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956768329_956768333 1 Left 956768329 3:72503356-72503378 CCCGCAGAAATAGTCCTACTAAG No data
Right 956768333 3:72503380-72503402 CTTTAGATATTGGAGTTATCAGG No data
956768329_956768334 25 Left 956768329 3:72503356-72503378 CCCGCAGAAATAGTCCTACTAAG No data
Right 956768334 3:72503404-72503426 ACAGATTAGAAACTAAGTGTTGG No data
956768329_956768332 -9 Left 956768329 3:72503356-72503378 CCCGCAGAAATAGTCCTACTAAG No data
Right 956768332 3:72503370-72503392 CCTACTAAGACTTTAGATATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956768329 Original CRISPR CTTAGTAGGACTATTTCTGC GGG (reversed) Intergenic
No off target data available for this crispr