ID: 956770969

View in Genome Browser
Species Human (GRCh38)
Location 3:72525707-72525729
Sequence AAACTGAGGCTCTCATAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956770969_956770973 -5 Left 956770969 3:72525707-72525729 CCAAGCTATGAGAGCCTCAGTTT No data
Right 956770973 3:72525725-72525747 AGTTTCCCCATTGGTAAAGAGGG No data
956770969_956770972 -6 Left 956770969 3:72525707-72525729 CCAAGCTATGAGAGCCTCAGTTT No data
Right 956770972 3:72525724-72525746 CAGTTTCCCCATTGGTAAAGAGG No data
956770969_956770978 17 Left 956770969 3:72525707-72525729 CCAAGCTATGAGAGCCTCAGTTT No data
Right 956770978 3:72525747-72525769 GACATAAATGTCACTTTGCAGGG No data
956770969_956770977 16 Left 956770969 3:72525707-72525729 CCAAGCTATGAGAGCCTCAGTTT No data
Right 956770977 3:72525746-72525768 GGACATAAATGTCACTTTGCAGG No data
956770969_956770979 24 Left 956770969 3:72525707-72525729 CCAAGCTATGAGAGCCTCAGTTT No data
Right 956770979 3:72525754-72525776 ATGTCACTTTGCAGGGTTATTGG No data
956770969_956770980 25 Left 956770969 3:72525707-72525729 CCAAGCTATGAGAGCCTCAGTTT No data
Right 956770980 3:72525755-72525777 TGTCACTTTGCAGGGTTATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956770969 Original CRISPR AAACTGAGGCTCTCATAGCT TGG (reversed) Intergenic
No off target data available for this crispr