ID: 956774614

View in Genome Browser
Species Human (GRCh38)
Location 3:72554676-72554698
Sequence ATGACCTGGCCAATATCCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956774611_956774614 0 Left 956774611 3:72554653-72554675 CCCTAAAAGCTGACTACTTCTAA No data
Right 956774614 3:72554676-72554698 ATGACCTGGCCAATATCCCTTGG No data
956774610_956774614 12 Left 956774610 3:72554641-72554663 CCTCTCTAAAAGCCCTAAAAGCT No data
Right 956774614 3:72554676-72554698 ATGACCTGGCCAATATCCCTTGG No data
956774612_956774614 -1 Left 956774612 3:72554654-72554676 CCTAAAAGCTGACTACTTCTAAA No data
Right 956774614 3:72554676-72554698 ATGACCTGGCCAATATCCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956774614 Original CRISPR ATGACCTGGCCAATATCCCT TGG Intergenic
No off target data available for this crispr