ID: 956779163

View in Genome Browser
Species Human (GRCh38)
Location 3:72590870-72590892
Sequence AGAGCACAGCGGAGGCCCCG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956779152_956779163 15 Left 956779152 3:72590832-72590854 CCCCCATCTGCACCGGAGGGCAC No data
Right 956779163 3:72590870-72590892 AGAGCACAGCGGAGGCCCCGGGG No data
956779156_956779163 12 Left 956779156 3:72590835-72590857 CCATCTGCACCGGAGGGCACGGC No data
Right 956779163 3:72590870-72590892 AGAGCACAGCGGAGGCCCCGGGG No data
956779157_956779163 3 Left 956779157 3:72590844-72590866 CCGGAGGGCACGGCCTACACGCT No data
Right 956779163 3:72590870-72590892 AGAGCACAGCGGAGGCCCCGGGG No data
956779154_956779163 13 Left 956779154 3:72590834-72590856 CCCATCTGCACCGGAGGGCACGG No data
Right 956779163 3:72590870-72590892 AGAGCACAGCGGAGGCCCCGGGG No data
956779153_956779163 14 Left 956779153 3:72590833-72590855 CCCCATCTGCACCGGAGGGCACG No data
Right 956779163 3:72590870-72590892 AGAGCACAGCGGAGGCCCCGGGG No data
956779158_956779163 -10 Left 956779158 3:72590857-72590879 CCTACACGCTTCAAGAGCACAGC No data
Right 956779163 3:72590870-72590892 AGAGCACAGCGGAGGCCCCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956779163 Original CRISPR AGAGCACAGCGGAGGCCCCG GGG Intergenic
No off target data available for this crispr