ID: 956779631

View in Genome Browser
Species Human (GRCh38)
Location 3:72593804-72593826
Sequence ACTAGGTCTTTACCCAGTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956779628_956779631 13 Left 956779628 3:72593768-72593790 CCAGGGCACATGTACAAGGCTGC No data
Right 956779631 3:72593804-72593826 ACTAGGTCTTTACCCAGTGATGG No data
956779627_956779631 14 Left 956779627 3:72593767-72593789 CCCAGGGCACATGTACAAGGCTG No data
Right 956779631 3:72593804-72593826 ACTAGGTCTTTACCCAGTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956779631 Original CRISPR ACTAGGTCTTTACCCAGTGA TGG Intergenic
No off target data available for this crispr