ID: 956780474

View in Genome Browser
Species Human (GRCh38)
Location 3:72599389-72599411
Sequence GCGCCCCGGCCAAGGTCCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956780474_956780484 7 Left 956780474 3:72599389-72599411 CCCTGGGACCTTGGCCGGGGCGC No data
Right 956780484 3:72599419-72599441 CCAGAGGCCTCCAGGTGTGCAGG No data
956780474_956780485 8 Left 956780474 3:72599389-72599411 CCCTGGGACCTTGGCCGGGGCGC No data
Right 956780485 3:72599420-72599442 CAGAGGCCTCCAGGTGTGCAGGG No data
956780474_956780478 -9 Left 956780474 3:72599389-72599411 CCCTGGGACCTTGGCCGGGGCGC No data
Right 956780478 3:72599403-72599425 CCGGGGCGCCCCAGAACCAGAGG No data
956780474_956780480 -1 Left 956780474 3:72599389-72599411 CCCTGGGACCTTGGCCGGGGCGC No data
Right 956780480 3:72599411-72599433 CCCCAGAACCAGAGGCCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956780474 Original CRISPR GCGCCCCGGCCAAGGTCCCA GGG (reversed) Intergenic
No off target data available for this crispr