ID: 956780741

View in Genome Browser
Species Human (GRCh38)
Location 3:72601191-72601213
Sequence CACTGGGTTCGCAGAGTCTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956780741_956780746 30 Left 956780741 3:72601191-72601213 CCTAAGACTCTGCGAACCCAGTG No data
Right 956780746 3:72601244-72601266 GTCACTTAAAAAGATTACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956780741 Original CRISPR CACTGGGTTCGCAGAGTCTT AGG (reversed) Intergenic
No off target data available for this crispr