ID: 956782230

View in Genome Browser
Species Human (GRCh38)
Location 3:72613087-72613109
Sequence TAATCCCTACAGCAGGTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956782224_956782230 15 Left 956782224 3:72613049-72613071 CCAAATTGTTTCTTTCTGTTAGG No data
Right 956782230 3:72613087-72613109 TAATCCCTACAGCAGGTGGGAGG No data
956782223_956782230 16 Left 956782223 3:72613048-72613070 CCCAAATTGTTTCTTTCTGTTAG No data
Right 956782230 3:72613087-72613109 TAATCCCTACAGCAGGTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956782230 Original CRISPR TAATCCCTACAGCAGGTGGG AGG Intergenic
No off target data available for this crispr