ID: 956784427

View in Genome Browser
Species Human (GRCh38)
Location 3:72630576-72630598
Sequence GGGGAGAAGCAGAAGGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956784424_956784427 -5 Left 956784424 3:72630558-72630580 CCTCAAAGCCAGGGGTTGGGGGA No data
Right 956784427 3:72630576-72630598 GGGGAGAAGCAGAAGGAAGAAGG No data
956784415_956784427 23 Left 956784415 3:72630530-72630552 CCTGCAAGTGCTTCAAGGCTTGT No data
Right 956784427 3:72630576-72630598 GGGGAGAAGCAGAAGGAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956784427 Original CRISPR GGGGAGAAGCAGAAGGAAGA AGG Intergenic
No off target data available for this crispr