ID: 956784557

View in Genome Browser
Species Human (GRCh38)
Location 3:72631634-72631656
Sequence AGATGGAGGCTGCATTTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956784557_956784561 -3 Left 956784557 3:72631634-72631656 CCATCCAAATGCAGCCTCCATCT No data
Right 956784561 3:72631654-72631676 TCTTACTATTGATACAGTCTCGG No data
956784557_956784562 -2 Left 956784557 3:72631634-72631656 CCATCCAAATGCAGCCTCCATCT No data
Right 956784562 3:72631655-72631677 CTTACTATTGATACAGTCTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956784557 Original CRISPR AGATGGAGGCTGCATTTGGA TGG (reversed) Intergenic
No off target data available for this crispr