ID: 956785476

View in Genome Browser
Species Human (GRCh38)
Location 3:72638701-72638723
Sequence ATTTCCCCCTAGGAGATCTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956785476_956785484 -6 Left 956785476 3:72638701-72638723 CCTTAGATCTCCTAGGGGGAAAT No data
Right 956785484 3:72638718-72638740 GGAAATGGGAGCAGGGAGCGGGG No data
956785476_956785482 -8 Left 956785476 3:72638701-72638723 CCTTAGATCTCCTAGGGGGAAAT No data
Right 956785482 3:72638716-72638738 GGGGAAATGGGAGCAGGGAGCGG No data
956785476_956785485 -1 Left 956785476 3:72638701-72638723 CCTTAGATCTCCTAGGGGGAAAT No data
Right 956785485 3:72638723-72638745 TGGGAGCAGGGAGCGGGGTTAGG No data
956785476_956785483 -7 Left 956785476 3:72638701-72638723 CCTTAGATCTCCTAGGGGGAAAT No data
Right 956785483 3:72638717-72638739 GGGAAATGGGAGCAGGGAGCGGG No data
956785476_956785490 15 Left 956785476 3:72638701-72638723 CCTTAGATCTCCTAGGGGGAAAT No data
Right 956785490 3:72638739-72638761 GGTTAGGGCAGAAGGGATGGTGG No data
956785476_956785488 8 Left 956785476 3:72638701-72638723 CCTTAGATCTCCTAGGGGGAAAT No data
Right 956785488 3:72638732-72638754 GGAGCGGGGTTAGGGCAGAAGGG No data
956785476_956785491 18 Left 956785476 3:72638701-72638723 CCTTAGATCTCCTAGGGGGAAAT No data
Right 956785491 3:72638742-72638764 TAGGGCAGAAGGGATGGTGGTGG No data
956785476_956785486 0 Left 956785476 3:72638701-72638723 CCTTAGATCTCCTAGGGGGAAAT No data
Right 956785486 3:72638724-72638746 GGGAGCAGGGAGCGGGGTTAGGG No data
956785476_956785487 7 Left 956785476 3:72638701-72638723 CCTTAGATCTCCTAGGGGGAAAT No data
Right 956785487 3:72638731-72638753 GGGAGCGGGGTTAGGGCAGAAGG No data
956785476_956785489 12 Left 956785476 3:72638701-72638723 CCTTAGATCTCCTAGGGGGAAAT No data
Right 956785489 3:72638736-72638758 CGGGGTTAGGGCAGAAGGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956785476 Original CRISPR ATTTCCCCCTAGGAGATCTA AGG (reversed) Intergenic
No off target data available for this crispr