ID: 956787575

View in Genome Browser
Species Human (GRCh38)
Location 3:72655313-72655335
Sequence TGTGCGACCGCAGGCGGCGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956787575_956787578 -3 Left 956787575 3:72655313-72655335 CCGGCGCCGCCTGCGGTCGCACA No data
Right 956787578 3:72655333-72655355 ACACACCTGAATTCCTGCACCGG No data
956787575_956787580 -1 Left 956787575 3:72655313-72655335 CCGGCGCCGCCTGCGGTCGCACA No data
Right 956787580 3:72655335-72655357 ACACCTGAATTCCTGCACCGGGG No data
956787575_956787579 -2 Left 956787575 3:72655313-72655335 CCGGCGCCGCCTGCGGTCGCACA No data
Right 956787579 3:72655334-72655356 CACACCTGAATTCCTGCACCGGG No data
956787575_956787587 29 Left 956787575 3:72655313-72655335 CCGGCGCCGCCTGCGGTCGCACA No data
Right 956787587 3:72655365-72655387 TGGCCCCCCGTGAGCACCGCCGG No data
956787575_956787588 30 Left 956787575 3:72655313-72655335 CCGGCGCCGCCTGCGGTCGCACA No data
Right 956787588 3:72655366-72655388 GGCCCCCCGTGAGCACCGCCGGG No data
956787575_956787582 9 Left 956787575 3:72655313-72655335 CCGGCGCCGCCTGCGGTCGCACA No data
Right 956787582 3:72655345-72655367 TCCTGCACCGGGGCAGCCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956787575 Original CRISPR TGTGCGACCGCAGGCGGCGC CGG (reversed) Intergenic