ID: 956787576

View in Genome Browser
Species Human (GRCh38)
Location 3:72655319-72655341
Sequence CAGGTGTGTGCGACCGCAGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956787576_956787580 -7 Left 956787576 3:72655319-72655341 CCGCCTGCGGTCGCACACACCTG No data
Right 956787580 3:72655335-72655357 ACACCTGAATTCCTGCACCGGGG No data
956787576_956787578 -9 Left 956787576 3:72655319-72655341 CCGCCTGCGGTCGCACACACCTG No data
Right 956787578 3:72655333-72655355 ACACACCTGAATTCCTGCACCGG No data
956787576_956787587 23 Left 956787576 3:72655319-72655341 CCGCCTGCGGTCGCACACACCTG No data
Right 956787587 3:72655365-72655387 TGGCCCCCCGTGAGCACCGCCGG No data
956787576_956787579 -8 Left 956787576 3:72655319-72655341 CCGCCTGCGGTCGCACACACCTG No data
Right 956787579 3:72655334-72655356 CACACCTGAATTCCTGCACCGGG No data
956787576_956787582 3 Left 956787576 3:72655319-72655341 CCGCCTGCGGTCGCACACACCTG No data
Right 956787582 3:72655345-72655367 TCCTGCACCGGGGCAGCCCTTGG No data
956787576_956787588 24 Left 956787576 3:72655319-72655341 CCGCCTGCGGTCGCACACACCTG No data
Right 956787588 3:72655366-72655388 GGCCCCCCGTGAGCACCGCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956787576 Original CRISPR CAGGTGTGTGCGACCGCAGG CGG (reversed) Intergenic
No off target data available for this crispr