ID: 956787577

View in Genome Browser
Species Human (GRCh38)
Location 3:72655322-72655344
Sequence ATTCAGGTGTGTGCGACCGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956787577_956787580 -10 Left 956787577 3:72655322-72655344 CCTGCGGTCGCACACACCTGAAT No data
Right 956787580 3:72655335-72655357 ACACCTGAATTCCTGCACCGGGG No data
956787577_956787587 20 Left 956787577 3:72655322-72655344 CCTGCGGTCGCACACACCTGAAT No data
Right 956787587 3:72655365-72655387 TGGCCCCCCGTGAGCACCGCCGG No data
956787577_956787582 0 Left 956787577 3:72655322-72655344 CCTGCGGTCGCACACACCTGAAT No data
Right 956787582 3:72655345-72655367 TCCTGCACCGGGGCAGCCCTTGG No data
956787577_956787588 21 Left 956787577 3:72655322-72655344 CCTGCGGTCGCACACACCTGAAT No data
Right 956787588 3:72655366-72655388 GGCCCCCCGTGAGCACCGCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956787577 Original CRISPR ATTCAGGTGTGTGCGACCGC AGG (reversed) Intergenic
No off target data available for this crispr