ID: 956787578

View in Genome Browser
Species Human (GRCh38)
Location 3:72655333-72655355
Sequence ACACACCTGAATTCCTGCAC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956787575_956787578 -3 Left 956787575 3:72655313-72655335 CCGGCGCCGCCTGCGGTCGCACA No data
Right 956787578 3:72655333-72655355 ACACACCTGAATTCCTGCACCGG No data
956787576_956787578 -9 Left 956787576 3:72655319-72655341 CCGCCTGCGGTCGCACACACCTG No data
Right 956787578 3:72655333-72655355 ACACACCTGAATTCCTGCACCGG No data
956787573_956787578 13 Left 956787573 3:72655297-72655319 CCTTGCAGCGGGGAGGCCGGCGC No data
Right 956787578 3:72655333-72655355 ACACACCTGAATTCCTGCACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956787578 Original CRISPR ACACACCTGAATTCCTGCAC CGG Intergenic
No off target data available for this crispr