ID: 956787579

View in Genome Browser
Species Human (GRCh38)
Location 3:72655334-72655356
Sequence CACACCTGAATTCCTGCACC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956787576_956787579 -8 Left 956787576 3:72655319-72655341 CCGCCTGCGGTCGCACACACCTG No data
Right 956787579 3:72655334-72655356 CACACCTGAATTCCTGCACCGGG No data
956787573_956787579 14 Left 956787573 3:72655297-72655319 CCTTGCAGCGGGGAGGCCGGCGC No data
Right 956787579 3:72655334-72655356 CACACCTGAATTCCTGCACCGGG No data
956787575_956787579 -2 Left 956787575 3:72655313-72655335 CCGGCGCCGCCTGCGGTCGCACA No data
Right 956787579 3:72655334-72655356 CACACCTGAATTCCTGCACCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956787579 Original CRISPR CACACCTGAATTCCTGCACC GGG Intergenic