ID: 956787580

View in Genome Browser
Species Human (GRCh38)
Location 3:72655335-72655357
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956787575_956787580 -1 Left 956787575 3:72655313-72655335 CCGGCGCCGCCTGCGGTCGCACA No data
Right 956787580 3:72655335-72655357 ACACCTGAATTCCTGCACCGGGG No data
956787576_956787580 -7 Left 956787576 3:72655319-72655341 CCGCCTGCGGTCGCACACACCTG No data
Right 956787580 3:72655335-72655357 ACACCTGAATTCCTGCACCGGGG No data
956787573_956787580 15 Left 956787573 3:72655297-72655319 CCTTGCAGCGGGGAGGCCGGCGC No data
Right 956787580 3:72655335-72655357 ACACCTGAATTCCTGCACCGGGG No data
956787577_956787580 -10 Left 956787577 3:72655322-72655344 CCTGCGGTCGCACACACCTGAAT No data
Right 956787580 3:72655335-72655357 ACACCTGAATTCCTGCACCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type