ID: 956787581

View in Genome Browser
Species Human (GRCh38)
Location 3:72655338-72655360
Sequence CTGCCCCGGTGCAGGAATTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956787581_956787597 25 Left 956787581 3:72655338-72655360 CCTGAATTCCTGCACCGGGGCAG No data
Right 956787597 3:72655386-72655408 GGGCCTCGTCCATGGCTGTCAGG No data
956787581_956787588 5 Left 956787581 3:72655338-72655360 CCTGAATTCCTGCACCGGGGCAG No data
Right 956787588 3:72655366-72655388 GGCCCCCCGTGAGCACCGCCGGG No data
956787581_956787587 4 Left 956787581 3:72655338-72655360 CCTGAATTCCTGCACCGGGGCAG No data
Right 956787587 3:72655365-72655387 TGGCCCCCCGTGAGCACCGCCGG No data
956787581_956787594 17 Left 956787581 3:72655338-72655360 CCTGAATTCCTGCACCGGGGCAG No data
Right 956787594 3:72655378-72655400 GCACCGCCGGGCCTCGTCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956787581 Original CRISPR CTGCCCCGGTGCAGGAATTC AGG (reversed) Intergenic
No off target data available for this crispr