ID: 956787582

View in Genome Browser
Species Human (GRCh38)
Location 3:72655345-72655367
Sequence TCCTGCACCGGGGCAGCCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956787577_956787582 0 Left 956787577 3:72655322-72655344 CCTGCGGTCGCACACACCTGAAT No data
Right 956787582 3:72655345-72655367 TCCTGCACCGGGGCAGCCCTTGG No data
956787576_956787582 3 Left 956787576 3:72655319-72655341 CCGCCTGCGGTCGCACACACCTG No data
Right 956787582 3:72655345-72655367 TCCTGCACCGGGGCAGCCCTTGG No data
956787573_956787582 25 Left 956787573 3:72655297-72655319 CCTTGCAGCGGGGAGGCCGGCGC No data
Right 956787582 3:72655345-72655367 TCCTGCACCGGGGCAGCCCTTGG No data
956787575_956787582 9 Left 956787575 3:72655313-72655335 CCGGCGCCGCCTGCGGTCGCACA No data
Right 956787582 3:72655345-72655367 TCCTGCACCGGGGCAGCCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956787582 Original CRISPR TCCTGCACCGGGGCAGCCCT TGG Intergenic
No off target data available for this crispr