ID: 956787583

View in Genome Browser
Species Human (GRCh38)
Location 3:72655346-72655368
Sequence GCCAAGGGCTGCCCCGGTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956787583_956787587 -4 Left 956787583 3:72655346-72655368 CCTGCACCGGGGCAGCCCTTGGC No data
Right 956787587 3:72655365-72655387 TGGCCCCCCGTGAGCACCGCCGG No data
956787583_956787599 23 Left 956787583 3:72655346-72655368 CCTGCACCGGGGCAGCCCTTGGC No data
Right 956787599 3:72655392-72655414 CGTCCATGGCTGTCAGGACCCGG No data
956787583_956787588 -3 Left 956787583 3:72655346-72655368 CCTGCACCGGGGCAGCCCTTGGC No data
Right 956787588 3:72655366-72655388 GGCCCCCCGTGAGCACCGCCGGG No data
956787583_956787600 24 Left 956787583 3:72655346-72655368 CCTGCACCGGGGCAGCCCTTGGC No data
Right 956787600 3:72655393-72655415 GTCCATGGCTGTCAGGACCCGGG No data
956787583_956787597 17 Left 956787583 3:72655346-72655368 CCTGCACCGGGGCAGCCCTTGGC No data
Right 956787597 3:72655386-72655408 GGGCCTCGTCCATGGCTGTCAGG No data
956787583_956787594 9 Left 956787583 3:72655346-72655368 CCTGCACCGGGGCAGCCCTTGGC No data
Right 956787594 3:72655378-72655400 GCACCGCCGGGCCTCGTCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956787583 Original CRISPR GCCAAGGGCTGCCCCGGTGC AGG (reversed) Intergenic
No off target data available for this crispr