ID: 956787584

View in Genome Browser
Species Human (GRCh38)
Location 3:72655352-72655374
Sequence CGGGGGGCCAAGGGCTGCCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956787584_956787600 18 Left 956787584 3:72655352-72655374 CCGGGGCAGCCCTTGGCCCCCCG No data
Right 956787600 3:72655393-72655415 GTCCATGGCTGTCAGGACCCGGG No data
956787584_956787588 -9 Left 956787584 3:72655352-72655374 CCGGGGCAGCCCTTGGCCCCCCG No data
Right 956787588 3:72655366-72655388 GGCCCCCCGTGAGCACCGCCGGG No data
956787584_956787594 3 Left 956787584 3:72655352-72655374 CCGGGGCAGCCCTTGGCCCCCCG No data
Right 956787594 3:72655378-72655400 GCACCGCCGGGCCTCGTCCATGG No data
956787584_956787599 17 Left 956787584 3:72655352-72655374 CCGGGGCAGCCCTTGGCCCCCCG No data
Right 956787599 3:72655392-72655414 CGTCCATGGCTGTCAGGACCCGG No data
956787584_956787587 -10 Left 956787584 3:72655352-72655374 CCGGGGCAGCCCTTGGCCCCCCG No data
Right 956787587 3:72655365-72655387 TGGCCCCCCGTGAGCACCGCCGG No data
956787584_956787602 30 Left 956787584 3:72655352-72655374 CCGGGGCAGCCCTTGGCCCCCCG No data
Right 956787602 3:72655405-72655427 CAGGACCCGGGATTAGCACGTGG No data
956787584_956787597 11 Left 956787584 3:72655352-72655374 CCGGGGCAGCCCTTGGCCCCCCG No data
Right 956787597 3:72655386-72655408 GGGCCTCGTCCATGGCTGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956787584 Original CRISPR CGGGGGGCCAAGGGCTGCCC CGG (reversed) Intergenic
No off target data available for this crispr