ID: 956787587

View in Genome Browser
Species Human (GRCh38)
Location 3:72655365-72655387
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956787577_956787587 20 Left 956787577 3:72655322-72655344 CCTGCGGTCGCACACACCTGAAT No data
Right 956787587 3:72655365-72655387 TGGCCCCCCGTGAGCACCGCCGG No data
956787581_956787587 4 Left 956787581 3:72655338-72655360 CCTGAATTCCTGCACCGGGGCAG No data
Right 956787587 3:72655365-72655387 TGGCCCCCCGTGAGCACCGCCGG No data
956787575_956787587 29 Left 956787575 3:72655313-72655335 CCGGCGCCGCCTGCGGTCGCACA No data
Right 956787587 3:72655365-72655387 TGGCCCCCCGTGAGCACCGCCGG No data
956787576_956787587 23 Left 956787576 3:72655319-72655341 CCGCCTGCGGTCGCACACACCTG No data
Right 956787587 3:72655365-72655387 TGGCCCCCCGTGAGCACCGCCGG No data
956787584_956787587 -10 Left 956787584 3:72655352-72655374 CCGGGGCAGCCCTTGGCCCCCCG No data
Right 956787587 3:72655365-72655387 TGGCCCCCCGTGAGCACCGCCGG No data
956787583_956787587 -4 Left 956787583 3:72655346-72655368 CCTGCACCGGGGCAGCCCTTGGC No data
Right 956787587 3:72655365-72655387 TGGCCCCCCGTGAGCACCGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type