ID: 956788990

View in Genome Browser
Species Human (GRCh38)
Location 3:72666113-72666135
Sequence CCTTCTATTGACACAATAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956788988_956788990 -5 Left 956788988 3:72666095-72666117 CCATTAGAGCATAGCTCTCCTTC No data
Right 956788990 3:72666113-72666135 CCTTCTATTGACACAATAGAAGG No data
956788987_956788990 -2 Left 956788987 3:72666092-72666114 CCTCCATTAGAGCATAGCTCTCC No data
Right 956788990 3:72666113-72666135 CCTTCTATTGACACAATAGAAGG No data
956788986_956788990 -1 Left 956788986 3:72666091-72666113 CCCTCCATTAGAGCATAGCTCTC No data
Right 956788990 3:72666113-72666135 CCTTCTATTGACACAATAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956788990 Original CRISPR CCTTCTATTGACACAATAGA AGG Intergenic
No off target data available for this crispr