ID: 956790902

View in Genome Browser
Species Human (GRCh38)
Location 3:72679293-72679315
Sequence AGCCCTGGGGAAACACAATG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956790890_956790902 14 Left 956790890 3:72679256-72679278 CCCTGCAAAATCCCCACCTCTCA No data
Right 956790902 3:72679293-72679315 AGCCCTGGGGAAACACAATGTGG No data
956790894_956790902 2 Left 956790894 3:72679268-72679290 CCCACCTCTCAACTCAGGTTCTG No data
Right 956790902 3:72679293-72679315 AGCCCTGGGGAAACACAATGTGG No data
956790893_956790902 3 Left 956790893 3:72679267-72679289 CCCCACCTCTCAACTCAGGTTCT No data
Right 956790902 3:72679293-72679315 AGCCCTGGGGAAACACAATGTGG No data
956790895_956790902 1 Left 956790895 3:72679269-72679291 CCACCTCTCAACTCAGGTTCTGG No data
Right 956790902 3:72679293-72679315 AGCCCTGGGGAAACACAATGTGG No data
956790898_956790902 -2 Left 956790898 3:72679272-72679294 CCTCTCAACTCAGGTTCTGGGAG No data
Right 956790902 3:72679293-72679315 AGCCCTGGGGAAACACAATGTGG No data
956790891_956790902 13 Left 956790891 3:72679257-72679279 CCTGCAAAATCCCCACCTCTCAA No data
Right 956790902 3:72679293-72679315 AGCCCTGGGGAAACACAATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956790902 Original CRISPR AGCCCTGGGGAAACACAATG TGG Intergenic
No off target data available for this crispr