ID: 956793688

View in Genome Browser
Species Human (GRCh38)
Location 3:72699895-72699917
Sequence CTGGATAACGCAGCCTTTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956793688_956793693 0 Left 956793688 3:72699895-72699917 CCAACAAAGGCTGCGTTATCCAG No data
Right 956793693 3:72699918-72699940 GCAGCTCCCACTGTGGGCAACGG No data
956793688_956793698 18 Left 956793688 3:72699895-72699917 CCAACAAAGGCTGCGTTATCCAG No data
Right 956793698 3:72699936-72699958 AACGGGAGCTTATCCCATGAGGG No data
956793688_956793690 -7 Left 956793688 3:72699895-72699917 CCAACAAAGGCTGCGTTATCCAG No data
Right 956793690 3:72699911-72699933 TATCCAGGCAGCTCCCACTGTGG No data
956793688_956793691 -6 Left 956793688 3:72699895-72699917 CCAACAAAGGCTGCGTTATCCAG No data
Right 956793691 3:72699912-72699934 ATCCAGGCAGCTCCCACTGTGGG No data
956793688_956793694 1 Left 956793688 3:72699895-72699917 CCAACAAAGGCTGCGTTATCCAG No data
Right 956793694 3:72699919-72699941 CAGCTCCCACTGTGGGCAACGGG No data
956793688_956793699 25 Left 956793688 3:72699895-72699917 CCAACAAAGGCTGCGTTATCCAG No data
Right 956793699 3:72699943-72699965 GCTTATCCCATGAGGGCCTTTGG No data
956793688_956793700 26 Left 956793688 3:72699895-72699917 CCAACAAAGGCTGCGTTATCCAG No data
Right 956793700 3:72699944-72699966 CTTATCCCATGAGGGCCTTTGGG No data
956793688_956793697 17 Left 956793688 3:72699895-72699917 CCAACAAAGGCTGCGTTATCCAG No data
Right 956793697 3:72699935-72699957 CAACGGGAGCTTATCCCATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956793688 Original CRISPR CTGGATAACGCAGCCTTTGT TGG (reversed) Intergenic
No off target data available for this crispr