ID: 956797945

View in Genome Browser
Species Human (GRCh38)
Location 3:72732960-72732982
Sequence CCTTGGTGCCAAGTATCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956797945_956797955 18 Left 956797945 3:72732960-72732982 CCTGCTGATACTTGGCACCAAGG No data
Right 956797955 3:72733001-72733023 TGGCCACGGTGCAGATGGGTGGG No data
956797945_956797949 -2 Left 956797945 3:72732960-72732982 CCTGCTGATACTTGGCACCAAGG No data
Right 956797949 3:72732981-72733003 GGAAGGATTCTTTCTAAGCCTGG No data
956797945_956797952 14 Left 956797945 3:72732960-72732982 CCTGCTGATACTTGGCACCAAGG No data
Right 956797952 3:72732997-72733019 AGCCTGGCCACGGTGCAGATGGG No data
956797945_956797951 13 Left 956797945 3:72732960-72732982 CCTGCTGATACTTGGCACCAAGG No data
Right 956797951 3:72732996-72733018 AAGCCTGGCCACGGTGCAGATGG No data
956797945_956797954 17 Left 956797945 3:72732960-72732982 CCTGCTGATACTTGGCACCAAGG No data
Right 956797954 3:72733000-72733022 CTGGCCACGGTGCAGATGGGTGG No data
956797945_956797950 4 Left 956797945 3:72732960-72732982 CCTGCTGATACTTGGCACCAAGG No data
Right 956797950 3:72732987-72733009 ATTCTTTCTAAGCCTGGCCACGG No data
956797945_956797957 20 Left 956797945 3:72732960-72732982 CCTGCTGATACTTGGCACCAAGG No data
Right 956797957 3:72733003-72733025 GCCACGGTGCAGATGGGTGGGGG No data
956797945_956797956 19 Left 956797945 3:72732960-72732982 CCTGCTGATACTTGGCACCAAGG No data
Right 956797956 3:72733002-72733024 GGCCACGGTGCAGATGGGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956797945 Original CRISPR CCTTGGTGCCAAGTATCAGC AGG (reversed) Intergenic
No off target data available for this crispr