ID: 956798889

View in Genome Browser
Species Human (GRCh38)
Location 3:72739286-72739308
Sequence GAGGGGGATTGTCGGTGGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956798889_956798905 25 Left 956798889 3:72739286-72739308 CCCATCCACCGACAATCCCCCTC No data
Right 956798905 3:72739334-72739356 GTGATTCAAGGAAATCCGACTGG No data
956798889_956798902 13 Left 956798889 3:72739286-72739308 CCCATCCACCGACAATCCCCCTC No data
Right 956798902 3:72739322-72739344 CCCCAGGTGCGAGTGATTCAAGG No data
956798889_956798906 28 Left 956798889 3:72739286-72739308 CCCATCCACCGACAATCCCCCTC No data
Right 956798906 3:72739337-72739359 ATTCAAGGAAATCCGACTGGAGG No data
956798889_956798897 -3 Left 956798889 3:72739286-72739308 CCCATCCACCGACAATCCCCCTC No data
Right 956798897 3:72739306-72739328 CTCCTCATCTTCCTTCCCCCAGG No data
956798889_956798907 29 Left 956798889 3:72739286-72739308 CCCATCCACCGACAATCCCCCTC No data
Right 956798907 3:72739338-72739360 TTCAAGGAAATCCGACTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956798889 Original CRISPR GAGGGGGATTGTCGGTGGAT GGG (reversed) Intergenic
No off target data available for this crispr