ID: 956809999

View in Genome Browser
Species Human (GRCh38)
Location 3:72855613-72855635
Sequence CAGGATCTGGCTGGGTACAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2245
Summary {0: 1, 1: 0, 2: 21, 3: 293, 4: 1930}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956809991_956809999 19 Left 956809991 3:72855571-72855593 CCAGAGAACCCTTCCTCATAGAT 0: 1
1: 0
2: 0
3: 10
4: 157
Right 956809999 3:72855613-72855635 CAGGATCTGGCTGGGTACAGTGG 0: 1
1: 0
2: 21
3: 293
4: 1930
956809994_956809999 6 Left 956809994 3:72855584-72855606 CCTCATAGATCACATGCATCAAA 0: 1
1: 0
2: 0
3: 18
4: 187
Right 956809999 3:72855613-72855635 CAGGATCTGGCTGGGTACAGTGG 0: 1
1: 0
2: 21
3: 293
4: 1930
956809993_956809999 10 Left 956809993 3:72855580-72855602 CCTTCCTCATAGATCACATGCAT 0: 1
1: 0
2: 1
3: 10
4: 183
Right 956809999 3:72855613-72855635 CAGGATCTGGCTGGGTACAGTGG 0: 1
1: 0
2: 21
3: 293
4: 1930
956809992_956809999 11 Left 956809992 3:72855579-72855601 CCCTTCCTCATAGATCACATGCA 0: 1
1: 0
2: 0
3: 20
4: 179
Right 956809999 3:72855613-72855635 CAGGATCTGGCTGGGTACAGTGG 0: 1
1: 0
2: 21
3: 293
4: 1930

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956809999 Original CRISPR CAGGATCTGGCTGGGTACAG TGG Intronic
Too many off-targets to display for this crispr